Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Class Reptilia identity card. How are they characterized according to examples of representing beings, basic morphology, skin, respiration, circulation, nitrogen waste, thermal control and types of reproduction?
Instance of representing beings: crocodiles, turtles, snakes, lizards, dinosaurs (extinct). Basic morphology: tetrapods, some with carapaces like turtles. Skin: impermeable keratinized, corneous plates known as scales. Respiration: pulmonary. Circulation: incomplete, closed, heart with three chambers and partial interventricular septation. Nitrogen waste: uric acid. Thermal control: heterothermic. Kind of reproduction: internal fecundation, sexual, shelled eggs with extraembryonic membranes.
Define the first step to envision the pattern of deformation. The first step in the analysis is to envision the pattern of deformation that would accompany such a failure. In t
Functions of Respiratory Pigments As you have learnt in the preceding sub-sections, the pigments are the carrier of oxygen. In the nonexistence of respiratory pigments the blo
Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon
Differential reinforcement of other behaviour (DRO) This is used to decrease frequent behaviour by reinforcing any behaviour other than the undesired one. An instance would be r
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Healthy Person X is walking on level ground. Which of the following is true for the knee extensor muscle of X's right leg during the step cycle? A. The right knee extensor mus
Which are the main cells of the nervous system? The major cells of the nervous system are the neurons. Besides the neurons the nervous system is also constituted of glial cells
what is the latest classification of fungi
What is the valve that separates the stomach from the esophagus called? What is its function? The valve that separates the stomach from the esophagus is the cardia. It has the
The Nurse's Role in Relieving the Child's Stres s Turning passive experiences into active ones that facilitate the child's healthy - Problems-I adjustment to hospitalization
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd