Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Concerning extracellular digestion what is meant by chemical digestion?
Chemical digestion is the series of enzymatic reactions to break macromolecules into smaller ones.
Q. Which kind of chemical reaction is the breaking of macromolecules into smaller ones that occurs in digestion? What are the enzymes that participate in this process called?
The reactions of the extracellular digestion are hydrolysis reactions that are breaking of molecules with the help of water, the enzymes that participate in digestion are hydrolytic enzymes.
Glands - 1 . SEBACEOUS GLAND - Absent in palm and sole. Holocrine in nature. Branched, alveoli are present, sac like in appearance. Generally attached to fo
What is autophagic intracellular digestion? Why is this type of intracellular digestion intensified in an organism undergoing starvation? Autophagic intracellular digestion is
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the life cycle of Water? The water cycle , or hydrologic cycle, is one of the most important processes to living organisms on Earth. Consider the following facts:
abnormal lung volumes and capacities
Define Iron deficiency anaemia During pregnancy? Iron deficiency anaemia (microcytic hypo chromic anaemia) is widespread among adolescents and young women during their reproduc
Explain prevention of endocarditis Many physicians believe that antimicrobial prophylaxis before process that may cause transient bacteremia can stop endocarditis and prostheti
what is cup shake?
A 'rag doll' seed tester Fold a square metre of muslin twice in the similar direction. Near one end mark out eight or ten squares about 5 cm by 5cm with a pencil. Number the sq
Assessment of Peripheral Vascular Disorders History Obtain the following information by interviewing the patient and family members Previous vascular surgery, previ
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd