What do you man by extracellular digestion, Biology

Assignment Help:

Q. Concerning extracellular digestion what is meant by chemical digestion?

Chemical digestion is the series of enzymatic reactions to break macromolecules into smaller ones.

Q. Which kind of chemical reaction is the breaking of macromolecules into smaller ones that occurs in digestion? What are the enzymes that participate in this process called?

The reactions of the extracellular digestion are hydrolysis reactions that are breaking of molecules with the help of water, the enzymes that participate in digestion are hydrolytic enzymes.


Related Discussions:- What do you man by extracellular digestion

Integumentary system - glands, Glands - 1 .      SEBACEOUS GLAND - ...

Glands - 1 .      SEBACEOUS GLAND - Absent in palm and sole. Holocrine in nature. Branched, alveoli are present, sac like in appearance. Generally attached to fo

What is autophagic intracellular digestion, What is autophagic intracellula...

What is autophagic intracellular digestion? Why is this type of intracellular digestion intensified in an organism undergoing starvation? Autophagic intracellular digestion is

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the life cycle of water, Explain the life cycle of Water? The ...

Explain the life cycle of Water? The water cycle , or hydrologic cycle, is one of the most important processes to living organisms on Earth. Consider the following facts:

Respiration, abnormal lung volumes and capacities

abnormal lung volumes and capacities

Define iron deficiency anaemia during pregnancy, Define Iron deficiency ana...

Define Iron deficiency anaemia During pregnancy? Iron deficiency anaemia (microcytic hypo chromic anaemia) is widespread among adolescents and young women during their reproduc

Explain prevention of endocarditis, Explain prevention of endocarditis ...

Explain prevention of endocarditis Many physicians believe that antimicrobial prophylaxis before process that may cause transient bacteremia can stop endocarditis and prostheti

Timber, what is cup shake?

what is cup shake?

Define a ''rag doll'' seed tester, A 'rag doll' seed tester Fold a squa...

A 'rag doll' seed tester Fold a square metre of muslin twice in the similar direction. Near one end mark out eight or ten squares about 5 cm by 5cm with a pencil. Number the sq

Assessment of peripheral vascular disorders - history, Assessment of Periph...

Assessment of Peripheral Vascular Disorders History Obtain the following information by interviewing the patient and family members Previous vascular surgery, previ

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd