1. Determine SNP variation among the aligned DNAs for a genomic region.   See below for how to count SNP variation.  The output file (Your_name_snp.txt) should have two columns of numbers.  The first column will indicate total number of SNP sites per species and the second will be the percent of sequences/species having that same number of variant nucleotides.
2. Determine in-del variation among the aligned DNAs for a genomic region. The output file (Your_name_in_del.txt) should be two columns of numbers.  The first column will indicate total number of in-del sites per species and the second will be the percent of sequences/species having that same number of in-del.
3. Determine overall variation (SNPs and in-dels) among the aligned DNAs for a genomic region. The output file (Your_name_both.txt) two columns of numbers.  The first column will indicate total number of variant sites (SNP and in-del) per species and the second will be the percent of sequences/species having that same number of variant nucleotides.  This will generate the same data used for the figure on page 3.

Sample Alignment: 48 bases,  differences are highlighted

Seq1      ATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq2      AAAAATGCATGCATGCATGCATGCATGCATGCATGCATGCATGCATGC

Seq3      AAAAATGCATGCATGCA-GCATGCATGCATGCATGCATGCATGCATGC

Seq4      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCATGCATGCATGC

Seq5      AAAAATGCATGCATGCA-GCATGCATGCATTTTTGCAT-CATGCATGC

Computation:  Compare Seq1 to 2,3,4, and 5 you find the differences (SNPs and InDels).

Seq1:Seq1 = 0 changes

Seq1:Seq2 = 3 changes

Seq1:Seq3 = 4 changes

Seq1:Seq4 = 7 changes

Seq1:Seq5 = 8 changes

 Repeat using each of the other sequences as the basis for comparison

Seq2:Seq1 = 3 changes                  Seq3:Seq1 = 4 changes

Seq2:Seq2 = 0 changes                  Seq3:Seq2 = 1 changes

Seq2:Seq3 = 1 changes                  Seq3:Seq3 = 0 changes

Seq2:Seq4 = 4 changes                  Seq3:Seq4 = 3 changes

Seq2:Seq5 = 5 changes                  Seq3:Seq5 = 4 changes

Seq4:Seq1 = 7 changes                  Seq5:Seq1 = 8 changes

Seq4:Seq2 = 4 changes                  Seq5:Seq2 = 5 changes

Seq4:Seq3 = 3 changes                  Seq5:Seq3 = 4 changes

Seq4:Seq4 = 0 changes                  Seq5:Seq4 = 1 changes

Seq4:Seq5 = 1 changes                  Seq5:Seq5 = 0 changes

Our input file is a FASTA format file of all sequences/species that has been previously aligned and trimmed.  There are some odd characters in the file, so we'll have to deal with that.