What are the structures that form the external ear, Biology

Assignment Help:

Q. What are the structures that form the external ear? What is its function?

The internal ear comprises the auricle or pinna and the auditory canal its function is to conduct the sound waves to the tympanum.


Related Discussions:- What are the structures that form the external ear

Hyphae and the mycelium of pluricellular fungi, Q What are the hyphae and t...

Q What are the hyphae and the mycelium of pluricellular fungi? The major structures of pluricellular fungi are the hyphae threadlike filaments made of contiguous uni or multinu

Photosynthesis Lab, How does light intensity affect oxygen production?

How does light intensity affect oxygen production?

Explain the primary function of blood, Explain the primary function of bloo...

Explain the primary function of blood? The primary function of the blood to transport oxygen from the lungs to body tissues for interior respiration. The blood helps in maintai

How are the triglycerides made, Q. How are the triglycerides made? Trig...

Q. How are the triglycerides made? Triglycerides, oils or fats, are made of one molecule of glycerol bound to three molecules of fatty acids. Hydroxyls of each one of the three

Explain adverse effects of ketoconazole, Explain Adverse Effects of ketocon...

Explain Adverse Effects of ketoconazole Anorexia, nausea and vomiting are common with higher doses (>400 mg/day) of ketoconazole; taking the drug with food or at bedtime may i

Why are additives used in foods?, Normal 0 false false fal...

Normal 0 false false false EN-US X-NONE X-NONE MicrosoftInternetExplorer4

Alkaline slant - carbohydrate utilization pattern test, Alkaline slant - Ob...

Alkaline slant - Observation for Carbohydrate Utilization Pattern Test Alkaline slant (red) and acid butt (yellow) with or without gas production - This indicates fermentation

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Do progeny shows all of the dominant phenotypes, Individuals of the followi...

Individuals of the following genotype are crossed: aa BB Cc Dd (crossed with) Aa Bb Cc Dd A) How many different phenotypes are possible for the progeny? B) What are the chanc

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd