What are the enzymes, Biology

Assignment Help:

Q. What are the enzymes? What is the significance of enzymes for living beings?

Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as catalysts that are non- consumable substances that reduce the activation energy necessary for a chemical reaction to occur.

Enzymes are highly specific to the reactions they catalyze. They are of fundamentally importance for life because most chemical reactions of the cells and tissues are catalyzed by enzymes. Without enzymatic action those reactions would not happen or would not occur in the required speed for the biological processes in which they participate.


Related Discussions:- What are the enzymes

Tertiary prevention- preventive strategies for food allergy, Define Tertiar...

Define Tertiary Prevention- preventive strategies for food allergy? Tertiary Prevention: Targets the control of factors that cause symptoms. This strategy would be appropriate

Demand and supply of medical care, Normal 0 false false fal...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Electrophoresis, Electrophoresis is the technique of separating the large ...

Electrophoresis is the technique of separating the large molecules (for instance DNA fragments or proteins) from the mixture of identical molecules. An electric current is passed

Venting of the heart in myocardial protection, Venting of the Heart :  It ...

Venting of the Heart :  It is important that heart does not distend during cardio pulmonary bypass. This is prevented by venting of the left side of the heart by inserting a cannu

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain elastase, Elastase The inactive  proelastase  is activated by t...

Elastase The inactive  proelastase  is activated by trypsin to the active form elastase. Elastase attacks  peptide  bonds  next  to  the  small amino  acid residues such  3s  g

Biology, how can i get an demo assignment to solve?

how can i get an demo assignment to solve?

Explain metabolic changes during infection, Explain Metabolic changes durin...

Explain Metabolic changes during infection With  the rise  in body  temperature above normal (98.4 0 F or 37°C) due  to infection several metabolic changes occur  in  the body

Explain huntington disease gene, Research methods used in studying a geneti...

Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de

Agro industrial-complete feed blocks, Complete feed blocks For manufac...

Complete feed blocks For manufacturing the pellets, processes such as grinding, mixing, steaming and pressing and some times extruding, are applied using special and expensive

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd