Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the enzymes? What is the significance of enzymes for living beings?
Enzymes are proteins that are catalysts of the chemical reactions. From Chemistry it is known as catalysts that are non- consumable substances that reduce the activation energy necessary for a chemical reaction to occur.
Enzymes are highly specific to the reactions they catalyze. They are of fundamentally importance for life because most chemical reactions of the cells and tissues are catalyzed by enzymes. Without enzymatic action those reactions would not happen or would not occur in the required speed for the biological processes in which they participate.
Define Tertiary Prevention- preventive strategies for food allergy? Tertiary Prevention: Targets the control of factors that cause symptoms. This strategy would be appropriate
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Electrophoresis is the technique of separating the large molecules (for instance DNA fragments or proteins) from the mixture of identical molecules. An electric current is passed
Venting of the Heart : It is important that heart does not distend during cardio pulmonary bypass. This is prevented by venting of the left side of the heart by inserting a cannu
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Elastase The inactive proelastase is activated by trypsin to the active form elastase. Elastase attacks peptide bonds next to the small amino acid residues such 3s g
how can i get an demo assignment to solve?
Explain Metabolic changes during infection With the rise in body temperature above normal (98.4 0 F or 37°C) due to infection several metabolic changes occur in the body
Research methods used in studying a genetic disease change with technological advances. These changes can be seen in Reading 22.1: Discovering the Huntington Disease Gene, which de
Complete feed blocks For manufacturing the pellets, processes such as grinding, mixing, steaming and pressing and some times extruding, are applied using special and expensive
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd