Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which of the following best defines the reasons why the sliding clamp is able to confer processivity on DNA polymerase and not DNA primase?
A. The sliding clamp coats the template strands and stops DNA primase from synthesizing new DNA strands.
B. The sliding clamp can induce a conformational change in DNA polymerase but not DNA primase. This conformational change permits polymerase but not primase to bind to the template.
C. The sliding clamp disassociates DNA primase from the template strand whereas securing DNA polymerase to the double helix.
D. The sliding clamp can physically associate with DNA polymerase but not DNA primase
Explain Theory or Principle of Determination of Coliforms? Coliforms are gram negative, non-spore forming, facultative anaerobic bacteria which produce acid and gas on lactose
Phylum Coelenterata characters anc classification
What name is given to the population of genetically identical offspring which result from a process of asexual (vegetative) reproduction? The population of genetically id
Q What is the logical order in which the concepts of molecules, atoms, cells... up to biosphere are associated? Atoms form molecules that form cells that form tissues that form
Protein structure is determined solely by a protein amino acid sequence. Should a genetically engineered protein in which the order of all amino acids is reversed therefore have th
What is signifying by "gene locus"? The Gene locus (locus means place) is the location of a gene in a chromosome that is the position of the gene in a DNA molecule
Q According to the cellular organization how are living beings divided into two groups? Cellular beings are divided into two groups, unicellular beings and the prokaryotes whos
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Jillian and Michael are in their freshman year at college. The two have been friends since grade school and the two of them enjoy getting together for dinner. Michael typically
PHYSICA L PROPERTIES All monosaccharides which have an asymmetric carbon are able to rotate polarized light either to left side ( laevorotatory ) or right side ( dextroro
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd