Illustrate the confer processivity on dna polymerase, Biology

Assignment Help:

Which of the following best defines the reasons why the sliding clamp is able to confer processivity on DNA polymerase and not DNA primase?

A. The sliding clamp coats the template strands and stops DNA primase from synthesizing new DNA strands.

B. The sliding clamp can induce a conformational change in DNA polymerase but not DNA primase. This conformational change permits polymerase but not primase to bind to the template.

C. The sliding clamp disassociates DNA primase from the template strand whereas securing DNA polymerase to the double helix.

D. The sliding clamp can physically associate with DNA polymerase but not DNA primase

 


Related Discussions:- Illustrate the confer processivity on dna polymerase

Explain theory or principle of determination of coliforms, Explain Theory o...

Explain Theory or Principle of Determination of Coliforms? Coliforms are gram negative, non-spore forming, facultative anaerobic bacteria which produce acid and gas on lactose

Phylum Coelenterata, Phylum Coelenterata characters anc classification

Phylum Coelenterata characters anc classification

Process of asexual reproduction, What name is given to the population of ge...

What name is given to the population of genetically identical offspring which result from a process of asexual (vegetative) reproduction?   The population of genetically id

Logical order in which molecules-atoms are associated, Q What is the logica...

Q What is the logical order in which the concepts of molecules, atoms, cells... up to biosphere are associated? Atoms form molecules that form cells that form tissues that form

Define a protein amino acid sequence, Protein structure is determined solel...

Protein structure is determined solely by a protein amino acid sequence. Should a genetically engineered protein in which the order of all amino acids is reversed therefore have th

What is signifying by “gene locus”?, What is signifying by "gene locus"? ...

What is signifying by "gene locus"? The Gene locus (locus means place) is the location of a gene in a chromosome that is the position of the gene in a DNA molecule

How are living beings divided into two groups?, Q According to the cellular...

Q According to the cellular organization how are living beings divided into two groups? Cellular beings are divided into two groups, unicellular beings and the prokaryotes whos

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the types of fats, Jillian and Michael are in their freshman year a...

Jillian and Michael are in their freshman year at college. The two have been friends since grade school and the two of them enjoy getting together for dinner. Michael typically

Physical properties of carbohydrates, PHYSICA L PROPERTIES All mono...

PHYSICA L PROPERTIES All monosaccharides which have an asymmetric carbon are able to rotate polarized light either to left side ( laevorotatory ) or right side ( dextroro

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd