What are compound eyes, Biology

Assignment Help:

Q. What are compound eyes?

Arthropods have compound eyes made of several visual units called as ommatidia. Each ommatidium transmits visual information through the optic nerve to the brain which interprets the image. Because they are numerous and round, these ommatidia, whose external surfaces point in different directions creating independent images, cause arthropod eyes have a large visual field, larger than the visual field of vertebrates, a few insects have one or more simple eye besides their pair of compound eyes.


Related Discussions:- What are compound eyes

Long-term treatment of maple syrup urine disease, Q. Long-term treatment of...

Q. Long-term treatment of maple syrup urine disease? Special feeds containing energy and proteins without the branched chain amino acids can be given to the infants. In some in

What is optic nerve, What is optic nerve The optic nerve contains more...

What is optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the e

Calculate the insulin bolus and drip rate , Mrs. M is a 35-year-old Hispani...

Mrs. M is a 35-year-old Hispanic female with no known past medical history; does not have a primary care provider (PCP). She presents to the emergency department with the following

Esophageal obstruction, E s o pha g e a l obstruction It is also...

E s o pha g e a l obstruction It is also known as choke. It may be acute or chronic and is characterized by inability to swallow, regurgitation and bloat. E t

What is angina pectoris, Q. What is Angina Pectoris? Chest discomfort i...

Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Endoplasmic reticulum, ENDOPLASMIC RETICULUM Bulk of the cytoplasmic  c...

ENDOPLASMIC RETICULUM Bulk of the cytoplasmic  compartment of a cell is occupied by complex , continuous  channel  system  in the form a network  of closed membrane bound and

Explain the relative nucleotide content of each sample, Can you help explai...

Can you help explain this question in fairly simple terminology? A certain sample of DNA has a Tm of 65oC, while another has a Tm of 58oC. What can you tell about the relative n

Accuracy of stress echocardiography, Q. Define Accuracy of Stress Echocardi...

Q. Define Accuracy of Stress Echocardiography? The accuracy of stress echo tests for the detection of coronary artery disease is expressed as the sensitivity and specificity of

Cerebrum, what term is used to indicate its grooves?

what term is used to indicate its grooves?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd