Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are compound eyes?
Arthropods have compound eyes made of several visual units called as ommatidia. Each ommatidium transmits visual information through the optic nerve to the brain which interprets the image. Because they are numerous and round, these ommatidia, whose external surfaces point in different directions creating independent images, cause arthropod eyes have a large visual field, larger than the visual field of vertebrates, a few insects have one or more simple eye besides their pair of compound eyes.
Q. Long-term treatment of maple syrup urine disease? Special feeds containing energy and proteins without the branched chain amino acids can be given to the infants. In some in
What is optic nerve The optic nerve contains more than one million axons that initiate in the ganglion cell layer of the retina. This structure originatcs at the back of the e
Mrs. M is a 35-year-old Hispanic female with no known past medical history; does not have a primary care provider (PCP). She presents to the emergency department with the following
E s o pha g e a l obstruction It is also known as choke. It may be acute or chronic and is characterized by inability to swallow, regurgitation and bloat. E t
Q. What is Angina Pectoris? Chest discomfort is often reported by most patients especially those which are chronic cases of dyslipidemia and/or hypertension. Like diarrhoea and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
ENDOPLASMIC RETICULUM Bulk of the cytoplasmic compartment of a cell is occupied by complex , continuous channel system in the form a network of closed membrane bound and
Can you help explain this question in fairly simple terminology? A certain sample of DNA has a Tm of 65oC, while another has a Tm of 58oC. What can you tell about the relative n
Q. Define Accuracy of Stress Echocardiography? The accuracy of stress echo tests for the detection of coronary artery disease is expressed as the sensitivity and specificity of
what term is used to indicate its grooves?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd