Waxes, Biology

Assignment Help:

WAXES

  1. These are monoglyceride compounds.
  2. They are chemically inert (due to absence of double bonds) and insoluble in water.
  3. On heating they become soft and pliable.
  4. On cooling they turn hard and water resistant.
  5. Waxes are common water repellent and lubricant lipids of plants and animals.
  6. Most land plants possess wax as bloom over fruits and other soft organs. It is also a component of cuticle over leaf surfae for reducing transpiration.
  7. In floating leaves the upper surface is covered by wax in order to prevent wetting and closing of stomata present on the upper surface.
  8. Lanolin (= lanoline) or wool fat is a wax secreted by cutaneous glands in fur bearing animals for providing a protective water proof coating to fur.
  9. Similarly water proof coating of wax occurs over feathers, human skin and insect skeleton.
  10. Whale, which consumes plankton in large quantity, comes to store the same lubricating wax, spermaceti, used to be got form Sperm Whale. It is the hardest wax.
  11. Bees wax is secreted by worker bees from their abdominal glands for building honey combs. It is formed by esterification of palmitic acid with mericyl and hexacosyl alcoholes. It's chemical name is meyricyl palmitate.
  12. Candle wax is a mixture of paraffin was (from petropleum) and stearic acid.
  13. Cerumen or ear wax is secreted by modified sweat glands or ceruminous glands present in the ear canal. It lubricates ear drum. It's more secretion is ciruminosis.

Related Discussions:- Waxes

Determine the statement- the evolution of color vision, Based on your readi...

Based on your reading of the article entitled "The Evolution of Color Vision", which of the following is a false statement? A. Trichomatic vision is found in all male and femal

What do you mean by myocarditis, Q. What do you mean by Myocarditis? My...

Q. What do you mean by Myocarditis? Myocarditis is defined as inflammation of the myocardium. The most common cause is Coxsackie B virus infection. But it can also be due to

Specify the term in detail - swim bladder, Specify the term in detail - Swi...

Specify the term in detail - Swim bladder. Found in bony fish, this gas-filled chamber is used to main neutral buoyancy. Oxygen in blood is added or removed as required. Swim b

Lipoproteins help in transport of lipids, Four major groups of lipoproteins...

Four major groups of lipoproteins help in transport of lipids. These include: 1.  Chylonzicrons-function is to carry dietary triacylglycerols 2.  Very  low  density lipoprot

Explain the inoculating loops and needles, Explain the Inoculating Loops an...

Explain the Inoculating Loops and Needles? These are most commonly used tools for inoculation. The inoculating loop consists of insulating handle at the end of which inoculatin

The hybridization reaction, As double-stranded DNA is heated a temperature ...

As double-stranded DNA is heated a temperature is reached at that the two reaction strands divided.  This procedure is called as denaturation.  The temperature at that half of the

Heart output, HEAR T OUTPUT The amount of blood pumped by heart per...

HEAR T OUTPUT The amount of blood pumped by heart per minute. Heart beat is 72. Pump out blood is 70 ml. This 72 × 70 = 5040 ml. ( 5 litres) blood is pumped in a minute.

Explain some effect of inadequate nutrition, Explain some Effect of Inadequ...

Explain some Effect of Inadequate nutrition? Inadequate nutrition ranks as one of the major problems of old age. Various factors which may be responsible for the change in one

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd