Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
main branches of biology
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Procedure for Test the Presence of Sugar in Honey? 1. Mix 5 grams of honey with 5 ml ether in a mortar and pestle. 2. Decant off the ether extract into an evaporating dish.
Pullulan Pullulan is a water soluble edible microbial polysaccharide consisting of Maltotriose units (α 1 → 6), as shown in the figure 2.12. It is produced by yeast Aureobasi
Explain the Proteus - Characteristics of Bacteria? It is gram negative, non-sporulating rod, which is characterized by rapid motility (peritrichous flagella) and swarming type
Categories of Air Pollutants From the above list you can see that the air pollutants can be broadly classified into the following two categories: Primary Pollutants
Ecological isolation is based on the fact that population shows preference to one habitat over the other. This extensive forests become barriers to the dispersal of organims living
What is the spontaneous generation hypothesis? The spontaneous generation hypothesys, or abiogenesis, asserts that life on earth has come from nonliving material. For instance,
Roles of Abscisic Acid Abscisic acid (ABA) is a particularly interesting hormone with regard to the regulation of its own levels. Its levels rise and fall dramatically in seve
Q. Etiological factor of gastritis? They are same as acute. Generally acute gastritis if well treated gets healed in 3-4 days, however if untreated can progress to chronic gast
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd