Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Theca - body form Protozoans
It is a close-fitting hard structure around the plasma membrane, mainly composed of cellulose. It can be compared with the ceil wall of a plant cell. Theca can be one to many layers thick but still remains flexible; sometimes it may become rigid after getting impregnated with inorganic salts. The surface of theca can be smooth and plain or rough and ornamented e.g. Glenodium.
Figure:Ornamental theca in Glenodium
Define Assessment of Magnesium Status and Dietary Requirements? In order to estimate Mg requirements and establish relationship between magnesium intake and deficiency, it is
Definition,functions and features of a mammalian lungs
Explain the Prevalence of iron deficiency anaemia? We can find out about the prevalence of anaemia if we know what percentage of population is suffering from anaemia. The WHO h
What are sori? The word "sori" is the plural form of "sorus". In ferns, a sorus (pl. sori) is a cluster of sporangia on the edge or underside of a fertile frond. In lots of spe
Give the results of DistaE Dissection ? Results : For acute dissection of different parts of aorta, the mortality is reported as 9 to 33 per cent. In the International Regis
Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem
It is IgE mediated hypersensitivity. Typical manifestations contain asthma, food allergies, eczema, hay fever etc.
what is gene?
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the bacteria? Bacteria are unicellular and prokaryotic beings. Bacteria have simple organization they present an exterior cell wall, plasma membrane, circular DNA w
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd