Theca - body form protozoans, Biology

Assignment Help:

Theca - body form Protozoans

It is a close-fitting hard structure around the plasma membrane, mainly composed of cellulose. It can be compared with the ceil wall of a plant cell. Theca can be one to many layers thick but still remains flexible; sometimes it may become rigid after getting impregnated with inorganic salts. The surface of theca can be smooth and plain or rough and ornamented e.g. Glenodium.

1022_Theca - body form Protozoans.png

Figure:Ornamental theca in Glenodium


Related Discussions:- Theca - body form protozoans

Assessment of magnesium status and dietary requirements, Define Assessment ...

Define Assessment of Magnesium Status and Dietary Requirements?  In order to estimate Mg requirements and establish relationship between magnesium intake and deficiency, it is

Mammalian lungs, Definition,functions and features of a mammalian lungs

Definition,functions and features of a mammalian lungs

Explain the prevalence of iron deficiency anaemia, Explain the Prevalence o...

Explain the Prevalence of iron deficiency anaemia? We can find out about the prevalence of anaemia if we know what percentage of population is suffering from anaemia. The WHO h

What are sori, What are sori? The word "sori" is the plural form of "so...

What are sori? The word "sori" is the plural form of "sorus". In ferns, a sorus (pl. sori) is a cluster of sporangia on the edge or underside of a fertile frond. In lots of spe

Give the results of distae dissection , Give the results of DistaE Dissecti...

Give the results of DistaE Dissection ? Results :  For acute dissection of different parts of aorta, the mortality is reported as 9 to 33 per cent. In the International Regis

What do you mean by cancer, Q. What is cancer? The Cancers are malign n...

Q. What is cancer? The Cancers are malign neoplasias that is abnormal and uncontrolled proliferation of cells that can disseminate to other sites of the body. The Cancer dissem

Explain 1st type of hypersensitivity, It is IgE mediated hypersensitivity. ...

It is IgE mediated hypersensitivity. Typical manifestations contain asthma, food allergies, eczema, hay fever etc.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What are the bacteria, Q. What are the bacteria? Bacteria are unicellul...

Q. What are the bacteria? Bacteria are unicellular and prokaryotic beings. Bacteria have simple organization they present an exterior cell wall, plasma membrane, circular DNA w

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd