Technical requirements for pulmonary angiography, Biology

Assignment Help:

Q. Technical Requirements for pulmonary angiography?

Digital subtraction pulmonary angiography with selective pulmonary arterial injections is vastly superior to conventional cut film angiography in all aspects except in resolution.

Contraindications

Absolute: None

Relative

1) Individuals with LBBB may develop complete heart block due to catheter trauma

2) Pulmonary hypertension

3) Anaphylactoid reaction to intravenous contrast

4) Patients on amiodarone

Venous Access

The femoral vein is the preferred venous access site. However, if there is proximal thrombus, then the alternative venous access sites are right or left internal jugular vein, right or left basilic vein in the antecubital fossa.


Related Discussions:- Technical requirements for pulmonary angiography

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Strawberry slain - common disorders of skin, Strawberry Slain: It  sig...

Strawberry Slain: It  signfies the dilatation  of deeper vessels  to form  cavernous spaces like those seen  in  the erectile tissue of the penis. The  lesion  is well-defined

Illustrate erythropoietin, Define Erythropoietin A. acts by stimulating...

Define Erythropoietin A. acts by stimulating the production of red blood cells by the peritubular interstitial cells of the kidney cortex. B. is secreted by cells in the bon

Spermatogenesis, Spermatogenesis In multicellular organisms the repro...

Spermatogenesis In multicellular organisms the reproductive process commences with the production of gametes. The gametes are the sex cells that develop inside the gonads, th

Where can these epithelia are found in the human body, How dissimilar is th...

How dissimilar is the simple cuboidal epithelium from the columnar epithelium? Where can these epithelia are found in the human body? The simple cuboidal epithelium is made of

Diagnosis of diabetes mellitus, Q. Diagnosis of diabetes mellitus? Time...

Q. Diagnosis of diabetes mellitus? Timely and proper diagnosis plays a key role not only in identifying new cases but also in managing old cases with or without diabetic compli

Explain the mechanisms of endosseous integration, Mechanisms Of Endosseous ...

Mechanisms Of Endosseous Integration Three terms may be used to describe individual aspects of bone formation process that can occur around implants. They are Osteoconduction,

Photosynthesis, explain the role of photophosphorylation and chemiosmosis i...

explain the role of photophosphorylation and chemiosmosis in photosynthesis

Explain the properties of good prebiotic, Explain the Properties of Good Pr...

Explain the Properties of Good Prebiotic? Thus, to summarize, we can say that a good prebiotic should have the following properties: Be active at a nutritionally feasibl

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd