Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Technical Requirements for pulmonary angiography?
Digital subtraction pulmonary angiography with selective pulmonary arterial injections is vastly superior to conventional cut film angiography in all aspects except in resolution.
Contraindications
Absolute: None
Relative
1) Individuals with LBBB may develop complete heart block due to catheter trauma
2) Pulmonary hypertension
3) Anaphylactoid reaction to intravenous contrast
4) Patients on amiodarone
Venous Access
The femoral vein is the preferred venous access site. However, if there is proximal thrombus, then the alternative venous access sites are right or left internal jugular vein, right or left basilic vein in the antecubital fossa.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Strawberry Slain: It signfies the dilatation of deeper vessels to form cavernous spaces like those seen in the erectile tissue of the penis. The lesion is well-defined
Define Erythropoietin A. acts by stimulating the production of red blood cells by the peritubular interstitial cells of the kidney cortex. B. is secreted by cells in the bon
Spermatogenesis In multicellular organisms the reproductive process commences with the production of gametes. The gametes are the sex cells that develop inside the gonads, th
How dissimilar is the simple cuboidal epithelium from the columnar epithelium? Where can these epithelia are found in the human body? The simple cuboidal epithelium is made of
basis of genetic transplantation
Q. Diagnosis of diabetes mellitus? Timely and proper diagnosis plays a key role not only in identifying new cases but also in managing old cases with or without diabetic compli
Mechanisms Of Endosseous Integration Three terms may be used to describe individual aspects of bone formation process that can occur around implants. They are Osteoconduction,
explain the role of photophosphorylation and chemiosmosis in photosynthesis
Explain the Properties of Good Prebiotic? Thus, to summarize, we can say that a good prebiotic should have the following properties: Be active at a nutritionally feasibl
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd