Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
State Diploblastic in brief.
Organisms formed from only two primitive cell layers- ectoderm and endoderm. Though there may be some type of a matrix between two cell layers, generally referred to as mesoglea or mesenchyme, it's not a true tissue layer.
Ask question #Minimum 2o pages accepted#
what can we do after reading biology???
Q. How is the depolarization of the neuronal plasma membrane generated? How does the cell return to its original rest? When the neuron receives a stimulus by the permeability o
1. List alternative therapies for musculoskeletal problems. 2. What is a xyrospasm? What is the Greek derivative of the word? 3. Name and describe the three types of varus con
Define Methods for determining pH? There are two general methods for determining pH of a solution. One is the colorimetric method and the other most common method is the use of
Explain Pancreatitis Pancreatitis :- Inflammation of the pancreas.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define the Bacillus cereus Bacillus cereus is not a common cause of food poisoning. It is a Gram positive, aerobic, spore forming rod shaped bacteria normally present in soil,
The vertebral bodies are much larger in the lower back than the neck. What is the functional significance of this structural difference?
SOM E COMMON REFLEXES RELATED TO RESPIRATION - 1. Cough Reflex: Due to stimulation in Trachea before it 2.5 lit. air is inhaled. 2. Sneezing Reflex: Stimulati
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd