State diploblastic in brief, Biology

Assignment Help:

State Diploblastic in brief.

Organisms formed from only two primitive cell layers- ectoderm and endoderm. Though there may be some type of a matrix between two cell layers, generally referred to as mesoglea or mesenchyme, it's not a true tissue layer.


Related Discussions:- State diploblastic in brief

Prawn.., Ask question #Minimum 2o pages accepted#

Ask question #Minimum 2o pages accepted#

Define depolarization of the neuronal plasma membrane, Q. How is the depola...

Q. How is the depolarization of the neuronal plasma membrane generated? How does the cell return to its original rest? When the neuron receives a stimulus by the permeability o

Orthopedics, 1. List alternative therapies for musculoskeletal problems. ...

1. List alternative therapies for musculoskeletal problems. 2. What is a xyrospasm? What is the Greek derivative of the word? 3. Name and describe the three types of varus con

Define methods for determining ph - nutritional biochemistry, Define Method...

Define Methods for determining pH? There are two general methods for determining pH of a solution. One is the colorimetric method and the other most common method is the use of

Explain pancreatitis, Explain Pancreatitis Pancreatitis :- Inflammati...

Explain Pancreatitis Pancreatitis :- Inflammation of the pancreas.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the bacillus cereus, Define the Bacillus cereus Bacillus cereus ...

Define the Bacillus cereus Bacillus cereus is not a common cause of food poisoning. It is a Gram positive, aerobic, spore forming rod shaped bacteria normally present in soil,

What is the functional importance of structural difference, The vertebral ...

The vertebral bodies are much larger in the lower back than the neck. What is the functional significance of this structural difference?

Reflexes related to respiration, SOM E COMMON REFLEXES RELATED TO RESPIRAT...

SOM E COMMON REFLEXES RELATED TO RESPIRATION - 1.      Cough Reflex: Due to stimulation in Trachea before it 2.5 lit. air is inhaled. 2.      Sneezing Reflex: Stimulati

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd