Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
GROWTH CURVES -
S-shaped or sigmoid -
Described by Verhuhst in 1839.
It shows 5 phases -
(i) Lag phase
(ii) Positive acceleration phase
(iii) Exponential phase
(iv) Negetive accesleration phase
(v) Stationary
1. Lag phase -
2. Positive acceleration phase -
3. Exponential phase -
4. Negetive accesleration phase -
5. Stationary -
If semi log curve is drawn for bacteria curve is in the form of straight line.
Explain the Position of the endospore? Endospore cannot be stained by ordinary methods such as simple staining and gram staining because these dyes do not penetrate the wall of
Define Steps in the Development of Exchange List? As mentioned above, when we group together similar food items so that each supplies a constant amount of a particular nutrient
Respiration – Protozoan Gas exchange occurs by the diffusion of oxygen across the cell membrane. Some protozoan utilize this oxygen but are also capable of anaerobic respirati
Explain what is Mortality in coronaw artery disease ? Marked prematurity and extensive atherosclerosis leads to markedly higher mortality in young Asian Indians compared to oth
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the kind of circulatory system present in annelids? In beings of the phylum Annelida the circulatory system is closed that is blood circulation takes place only with
Cori Cycle Skeletal muscles have some mitochondria, yet are competent of vigorous activity. as a output, the little stores of oxygen are rapidly depleted, causing the muscle ti
Homomorphic Types - Intra specific Incompatibility It is characterized by morphologically indistinguishable mating types within a species. A proper breeding is required for th
How can the abundance and diversity of living beings in the tropical forests be explained? The biodiversity of these ecosystems can be defined by the great availability of the
Q. Which is the typical feature of the hookworms related to the way they obtain food and explore the host? Both The Necator americanus and Ancylostoma duodenale have mouthparts
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd