Sigmoid growth curve, Biology

Assignment Help:

GROWTH CURVES -

S-shaped or sigmoid -

Described by Verhuhst in 1839.

It shows 5 phases -

(i) Lag phase

(ii) Positive acceleration phase

(iii) Exponential phase

(iv) Negetive accesleration phase

(v) Stationary

1480_sigmoid growth curve.png

1.       Lag phase -

  • Early stage of curve.
  • When new individuals come in new environment so minimum growth occur in these phase.
  • It is due to absence of new resources.
  • It is due to lack of adaptations.

2.       Positive acceleration phase -

  • Growth rate is increased.
  • Birth rate increases.
  • Death rate is minimum.

3.       Exponential phase -

  • Individuals become adaptated.
  • Rapid growth occur.
  • Birth rate very high.
  • Death rate very low.

4.       Negetive accesleration phase -

  • Growth rate decreases.
  • Available sources become limited.

5.       Stationary -

  • Resources are limited.
  • Birth rate is equal to death rate.
  • So growth rate is zero.
  • In the growth curve of bacteria after stationary phase growth decreases due to unavailability of resources.

2258_sigmoid growth curve1.png

If semi log curve is drawn for bacteria curve is in the form of straight line.

897_sigmoid growth curve2.png


Related Discussions:- Sigmoid growth curve

Explain the position of the endospore, Explain the Position of the endospor...

Explain the Position of the endospore? Endospore cannot be stained by ordinary methods such as simple staining and gram staining because these dyes do not penetrate the wall of

Define steps in the development of exchange list, Define Steps in the Devel...

Define Steps in the Development of Exchange List? As mentioned above, when we group together similar food items so that each supplies a constant amount of a particular nutrient

Respiration – protozoan, Respiration – Protozoan Gas exchange occurs b...

Respiration – Protozoan Gas exchange occurs by the diffusion of oxygen across the cell membrane. Some protozoan utilize this oxygen but are also capable of anaerobic respirati

Explain what is mortality in coronaw artery disease, Explain what is Mortal...

Explain what is Mortality in coronaw artery disease ? Marked prematurity and extensive atherosclerosis leads to markedly higher mortality in young Asian Indians compared to oth

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

What is the kind of circulatory system present in annelids, Q. What is the ...

Q. What is the kind of circulatory system present in annelids? In beings of the phylum Annelida the circulatory system is closed that is blood circulation takes place only with

Cori cycle, Cori Cycle Skeletal muscles have some mitochondria, yet are...

Cori Cycle Skeletal muscles have some mitochondria, yet are competent of vigorous activity. as a output, the little stores of oxygen are rapidly depleted, causing the muscle ti

Homomorphic types - intra specific incompatibility, Homomorphic Types - Int...

Homomorphic Types - Intra specific Incompatibility It is characterized by morphologically indistinguishable mating types within a species. A proper breeding is required for th

How can the abundance and diversity of living beings, How can the abundance...

How can the abundance and diversity of living beings in the tropical forests be explained? The biodiversity of these ecosystems can be defined by the great availability of the

Feature of the hookworms related to the way they obtain food, Q. Which is t...

Q. Which is the typical feature of the hookworms related to the way they obtain food and explore the host? Both The Necator americanus and Ancylostoma duodenale have mouthparts

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd