Show the structures of human auditory sensitivity, Biology

Assignment Help:

Q. What are the structures that participate in the human auditory sensitivity?

The structures of the human auditory sensitivity are the ears (middle and internal, external) the vestibulocochlear nerves and the auditory areas of the brain located in the temporal lobes of both hemispheres.


Related Discussions:- Show the structures of human auditory sensitivity

Acid rain, The Phenomenon of acid rain was first introduced by Rober Angus ...

The Phenomenon of acid rain was first introduced by Rober Angus smith in 1852. Is means presence of excessive acids in rain water? Acid rain is a form of precipitation (rain, sn

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Parazoans and simplest metazoans, in what aspect are the cnidarians similar...

in what aspect are the cnidarians similar to protozoans? to the poriferans?

Give three examples of abiotic factors, Give three examples of abiotic fact...

Give three examples of abiotic factors and explain how they interact. Abiotic factors contain temperature, humidity, pH, salinity, O 2 concentration, amount of sunlight, avail

Organic tricuspid regurgitation, Organic Tricuspid Regurgitation Here ...

Organic Tricuspid Regurgitation Here the valve is anatomically abnormal. Etiology of Organic tricuspid regurgitation: 1) Rheumatic 2) Non rheumatic 1. Infective e

Explain the deficiency and toxicity of vitamin a, Explain the Deficiency an...

Explain the Deficiency and Toxicity of vitamin A? Who defines VAD as tissue concentrations of vitamin A low enough to have adverse health consequences even if there is no evide

State the goals of neuropsychological assessment, State the Goals of neurop...

State the Goals of neuropsychological assessment The psychological domains/processes/ components are mediated by specific brain structures and connected brain structures formin

Pulmonary autograft and ross procedure, Pulmonary Autograft and Ross Proced...

Pulmonary Autograft and Ross Procedure :  Sir Donald Ross in 1967 introduced the concept of using patient's own pulmonary valve (autograft) for aortic valve replacement and a pul

Pituitary disorders, PITUITARY DISORDERS - (a) Pituitary Dwarfism . It...

PITUITARY DISORDERS - (a) Pituitary Dwarfism . It is caused by the deficiency of growth hormones (GH) from childhood. It is characterised by small but well porportioned body a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd