Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What are the structures that participate in the human auditory sensitivity?
The structures of the human auditory sensitivity are the ears (middle and internal, external) the vestibulocochlear nerves and the auditory areas of the brain located in the temporal lobes of both hemispheres.
The Phenomenon of acid rain was first introduced by Rober Angus smith in 1852. Is means presence of excessive acids in rain water? Acid rain is a form of precipitation (rain, sn
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
what is the bioindicator of water pollution.
in what aspect are the cnidarians similar to protozoans? to the poriferans?
Give three examples of abiotic factors and explain how they interact. Abiotic factors contain temperature, humidity, pH, salinity, O 2 concentration, amount of sunlight, avail
Organic Tricuspid Regurgitation Here the valve is anatomically abnormal. Etiology of Organic tricuspid regurgitation: 1) Rheumatic 2) Non rheumatic 1. Infective e
Explain the Deficiency and Toxicity of vitamin A? Who defines VAD as tissue concentrations of vitamin A low enough to have adverse health consequences even if there is no evide
State the Goals of neuropsychological assessment The psychological domains/processes/ components are mediated by specific brain structures and connected brain structures formin
Pulmonary Autograft and Ross Procedure : Sir Donald Ross in 1967 introduced the concept of using patient's own pulmonary valve (autograft) for aortic valve replacement and a pul
PITUITARY DISORDERS - (a) Pituitary Dwarfism . It is caused by the deficiency of growth hormones (GH) from childhood. It is characterised by small but well porportioned body a
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd