Rigs pattern - types of nursing units, Biology

Assignment Help:

Rigs Pattern:

The nursing unit has been divided into small cubicles for 1,2,4  and 6 beds.  The beds are arranged parallel to the  longitudinal wall.  The pattern was first built in Rigs hospital in Copenhagen and it still bears the name of Rigs pattern. In this pattern there is difficulty in communication between the nurse and the patient. It also reduces visibility and observation of the patient, wards become longer, consequently the nurse has to walk more and increase number of nurses required.  

Installing call bells, signal lights, or closed circuit TV  can overcome rigs pattern. To reduce the walking distance wards may be designed in T, E, and-Y shape or with double  comdor.  

1460_ring.png

Better support space  in the 1950s also  limited visibility from the nurse station to some patient rooms and elongated nurse travel distances.  

Circular:

Circular  configurations of  the 1970s shortened travel paths for nurses, but limited, the potential for architectural adaptability. It also meant inadequate support space and storage.  

1476_ring1.png


Related Discussions:- Rigs pattern - types of nursing units

What does radial symmetry mean, What does radial symmetry mean? What is the...

What does radial symmetry mean? What is the type of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radial

Rheumatic heart disease, Rheumatic heart disease was the predisposing cardi...

Rheumatic heart disease was the predisposing cardiac lesion for IE in 20 to 25 per cent. In patients with rheumatic heart disease, endocarditis occurs most frequently on the mitral

Explain about biological diversity, Q. Explain about biological diversity? ...

Q. Explain about biological diversity? Biodiversity or biological diversity is a neologism and portmanteau word, from bio and diversity. It is the diversity of and in living na

Lymph, Why lymph is also called middle man of body

Why lymph is also called middle man of body

Ability of mammalian kidney, Normal 0 false false false ...

Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4

Define about the glutathione peroxidases - selenium, Define about the Gluta...

Define about the Glutathione peroxidases - Selenium? The role of selenium in the cytosolic enzyme, glutathione peroxidase (GSHPx), was first illustrated in 1973. Four selenium

Metamorphosis in amphibians, Metamorphosis in Amphibians Metamorphosi...

Metamorphosis in Amphibians Metamorphosis is radical in anurans, slight or not exists in urodeles. In anuran amphibians like toads and most frogs, metamorphosis is generally

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Blood from the fetus circulates through the placenta, Blood from the fetus ...

Blood from the fetus circulates through the placenta. a) What substances pass (i) from the maternal to the fetal blood, (ii) from the fetal to the maternal blood?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd