Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Rigs Pattern:
The nursing unit has been divided into small cubicles for 1,2,4 and 6 beds. The beds are arranged parallel to the longitudinal wall. The pattern was first built in Rigs hospital in Copenhagen and it still bears the name of Rigs pattern. In this pattern there is difficulty in communication between the nurse and the patient. It also reduces visibility and observation of the patient, wards become longer, consequently the nurse has to walk more and increase number of nurses required.
Installing call bells, signal lights, or closed circuit TV can overcome rigs pattern. To reduce the walking distance wards may be designed in T, E, and-Y shape or with double comdor.
Better support space in the 1950s also limited visibility from the nurse station to some patient rooms and elongated nurse travel distances.
Circular:
Circular configurations of the 1970s shortened travel paths for nurses, but limited, the potential for architectural adaptability. It also meant inadequate support space and storage.
What does radial symmetry mean? What is the type of symmetry found in chordates? Which are other phyla of the animal kingdom that present species with radial symmetry? Radial
Rheumatic heart disease was the predisposing cardiac lesion for IE in 20 to 25 per cent. In patients with rheumatic heart disease, endocarditis occurs most frequently on the mitral
Q. Explain about biological diversity? Biodiversity or biological diversity is a neologism and portmanteau word, from bio and diversity. It is the diversity of and in living na
Why lymph is also called middle man of body
what is plasmodium
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Define about the Glutathione peroxidases - Selenium? The role of selenium in the cytosolic enzyme, glutathione peroxidase (GSHPx), was first illustrated in 1973. Four selenium
Metamorphosis in Amphibians Metamorphosis is radical in anurans, slight or not exists in urodeles. In anuran amphibians like toads and most frogs, metamorphosis is generally
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Blood from the fetus circulates through the placenta. a) What substances pass (i) from the maternal to the fetal blood, (ii) from the fetal to the maternal blood?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd