Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Retroviral method: A retrovirus is a virus that carries its genetic material in the form of RNA rather than DNA. In this method retroviruses are used as vectors to transfer genetic material into the host cell, resulting in a chimera, an organism consisting of tissues or parts of diverse genetic constitution. Chimeras are inbred for as many as 20 generations until homozygous (carrying the desired transgene in every cell) transgenic offsprings are born. The method was successfully used in 1974 when a simian virus was inserted into mice embryos, resulting in mice carrying this DNA. In retroviral method, 8-cell stage embryo is removed and infected by virus carrying foreign gene. The retroviral is made defective in such a way that, it can effectively penetrate cells without replication. The transformed embryo is then implanted back in foster mother. After birth, the matings are carried out to establish transgenic line. Although retrovirus is a good choice as a vector, it can carry only a limited size of the foreign DNA.
Where does hematopoiesis occur? Hematopoiesis happens in the bone marrow (mainly within flat bones), where erythrocytes, leukocytes and platelets are made, and in the lymphoid
The percentage of oxygen absorbed from the air in the lungs is always about the similar, so how can the oxygen supply to the blood be enhanced during vigorous activity? Breathi
Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully
modes of nutrition in rat
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. Function of Noradrenaline in consciousness? Increased level of noradrenalin is implicated in wakefulness. Locus coeruleus noradrenergic neurons decrease their rate of firing
Explain Water soluble vitamins for Infants? Thiamin, riboflavin and niacin requirements are met through breast milk alone and solely breast-fed infants meet their requirements.
A zoologist is investigating a population of squirrels whose coat color is controlled by a single gene whose two alleles (B1 & B2) are codominant. B1B1 individuals are black, B1B2
Acute Complications of PTCA : The incidence of complications after PTCA that require emergency surgery has reduced considerably in the present era. Introduction of stents, pe
Explain the Chemical Properties of Monosaccharides? As you already know the chemical properties of monosaccharides depend on the presence of the hydroxyl the aldehyde or the ke
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd