Retroviral method for gene transfer, Biology

Assignment Help:

Retroviral method: A retrovirus is a virus that carries its genetic material in the form of RNA rather than DNA. In this method retroviruses are used as vectors to transfer genetic material into the host cell, resulting in a chimera, an organism consisting of tissues or parts of diverse genetic constitution. Chimeras are inbred for as many as 20 generations until homozygous (carrying the desired transgene in every cell) transgenic offsprings are born. The method was successfully used in 1974 when a simian virus was inserted into mice embryos, resulting in mice carrying this DNA. In retroviral method, 8-cell stage embryo is removed and infected by virus carrying foreign gene. The retroviral is made defective in such a way that, it can effectively penetrate cells without replication.  The transformed embryo is then implanted back in foster mother. After birth, the matings are carried out to establish transgenic line. Although retrovirus is a good choice as a vector, it can carry only a limited size of the foreign DNA.


Related Discussions:- Retroviral method for gene transfer

Where does hematopoiesis occur, Where does hematopoiesis occur? Hematop...

Where does hematopoiesis occur? Hematopoiesis happens in the bone marrow (mainly within flat bones), where erythrocytes, leukocytes and platelets are made, and in the lymphoid

Blood be enhanced during vigorous activity, The percentage of oxygen absorb...

The percentage of oxygen absorbed from the air in the lungs is always about the similar, so how can the oxygen supply to the blood be enhanced during vigorous activity? Breathi

Explain the management of middle - third perforation, Explain the Managemen...

Explain the Management of Middle - Third Perforation Same to coronal one-third perforation, except defects located more deeper from the access cavity. For successfully

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Function of noradrenaline in consciousness, Q. Function of Noradrenaline in...

Q. Function of Noradrenaline in consciousness? Increased level of noradrenalin is implicated in wakefulness. Locus coeruleus noradrenergic neurons decrease their rate of firing

Explain water soluble vitamins for infants, Explain Water soluble vitamins ...

Explain Water soluble vitamins for Infants? Thiamin, riboflavin and niacin requirements are met through breast milk alone and solely breast-fed infants meet their requirements.

What might explain the pattern, A zoologist is investigating a population o...

A zoologist is investigating a population of squirrels whose coat color is controlled by a single gene whose two alleles (B1 & B2) are codominant. B1B1 individuals are black, B1B2

Acute complications of ptca, Acute Complications of PTCA :  The incide...

Acute Complications of PTCA :  The incidence of complications after PTCA that require emergency surgery has reduced considerably in the present era. Introduction of stents, pe

Explain the chemical properties of monosaccharides, Explain the Chemical Pr...

Explain the Chemical Properties of Monosaccharides? As you already know the chemical properties of monosaccharides depend on the presence of the hydroxyl the aldehyde or the ke

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd