Raw material for industry - impacts on biodiversity, Biology

Assignment Help:

Raw Material for Industry - impacts on biodiversity

The industry, producing goods and services, relies and impacts on biodiversity directly. Much of the raw material that goes into industrial operations is a by-product of biodiversity. The trees, the animal organs, the microbial culture are a few examples of sources of raw materials. Plants and animals provide a wide variety of resources used in industry and commerce for both domestic and commercial markets. As many as 2000 plant species throughout the world are known for their economic importance. The building, furniture and paper making industries are dependent on more than one hundred different species of trees. Cotton, flax, hemp and jute provide fibre for manufacture of textiles, ropes and other articles. For example, plant extracts are used in the manufacture of glues, soaps, cosmetics, dyes, paints, plastics, lubricants and polishes. Household implements such as needles and hooks are made from horns, scales and fins of animal origin. Fat from wild species (e.g. marine mammals and sharks) is used to produce a range of oils. Wildlife products such as cane and other lianas, bark, fur, hides, scales, bones and feathers are used to make a vari ety of clothing and utensils.

The silk industry is dependent on several species of silkworms, but the finest silk is obtained from the mulberry silk moth, which is now domesticated. The moth pupae which are left after extracting the silk during sericulture, are used to produce soap and cosmetics. Cochineal, a brilliant red colouring agent formerly widely used in the food and cloth industries, is also an insect product obtained from the semi -domesticated form of a scale insect.


Related Discussions:- Raw material for industry - impacts on biodiversity

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Estimate the frequency of heterozygotes for allel, Phenylketonuria is a sev...

Phenylketonuria is a severe form of mental disability caused by a homozygous recessive allele. The condition affects about 1 in 10,000 neborn Caucasians. Estimate the frequency of

Light harvesting in green plants, Sunlight is absorbed by chlorophyll molec...

Sunlight is absorbed by chlorophyll molecules.  Chlorophyll is a porphyrin in that nitrogen atoms are coordinated to a magnesium ion instance for it is a magnesium porphyrin.  This

What is the leaf cuticle, What is the leaf cuticle? The leaf cuticle is...

What is the leaf cuticle? The leaf cuticle is a thin waxy layer made of cutin and waxes on the outer surface of the leaf epidermis. Its function is to control the cellular tran

Explain about ridge mapping, Explain about Ridge mapping Ridge relation...

Explain about Ridge mapping Ridge relationship is also critical especially in cases with multiple implants and fixed prosthesis, which is an advanced treatment procedure. But,

Explain water-soluble and fat-soluble vitamins, What is the difference betw...

What is the difference between water-soluble and fat-soluble vitamins? Why can fat-soluble vitamins cause harm when ingested in excess? Water-soluble vitamins are those soluble

Define isolated soybean proteins in cereal products, Define isolated soybea...

Define isolated soybean proteins in Cereal products? ISP is sometimes used instead of, or in combination with isolates and soy flour, in the formulation of milk replacer mixtur

Explain the primary root growth, Explain the Primary Root Growth? Prim...

Explain the Primary Root Growth? Primary Growth in Roots :  Roots grow down and through the soil by adding new cells at the tip of the root (called the root tip). There is a

Functions of cell wall, FUNCTIONS OF CELL WALL 1.       Provides shape ...

FUNCTIONS OF CELL WALL 1.       Provides shape to plant cell rigidity to cells. 2.       Functions as a barrier to entry of pathogens into the cells. 3.       Provides pr

What are chylomicrons, What are chylomicrons? Yes, so you now know that...

What are chylomicrons? Yes, so you now know that chylomicrons are basically lipoprotein molecules which are water miscible. They are poured into lymphatic vessels through lacte

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd