Pulmonary function tests - diagnostic tests, Biology

Assignment Help:

Pulmonary  Function Test:

Pulmonary functions  tests (PFTs) provide information about a clients manifestation by measuring lung volumes, lung mechanics, and diffusion capabilities of the lungs. PFTs peribrmed in a pulmonary function laboratory can measure respiratory volumes and capabilities. On the other hand, PFTs done outside of a laboratory are modified to include ventilation tests of forced expiratory volume, vital capacity, and maximal voluntary ventilation measures. A handheld measure of  inspiratory flow is called a peak flow. Many clients with asthma use a peak  flowmeter at home to monitor changes in their condition and responses to treatment.

Education about the purpose, procedure, and implications of the  test  is performed by  the nurse and reinforced by the examiner. Explicit  instructions of each maneuver are given during the  testing. Instruct clients that  it  is  normal to feel short of breath after the test. Clients should not  smoke or use a bronchodilator 6 hours before undergoing a PFT. 

 


Related Discussions:- Pulmonary function tests - diagnostic tests

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Why is the important when blood is flowing, Where are the openings into the...

Where are the openings into the coronary arteries? Why is this important when blood is flowing?

What is herbicide tolerant crops in evolutionary, Evolutionary ...

Evolutionary Herbicide tolerant crops (HTC) Increased use of herbicide can result in increase in development of weed resistance to that herbicide either through

Foods for growth in microorganisms, Q. Foods for Growth in microorganisms? ...

Q. Foods for Growth in microorganisms? Microorganisms differ in their ability to use various nitrogenous compounds as a source of nitrogen for growth. The primary nitrogen sour

Use of toxic amino acids, Q. Explain Use of Toxic amino acids? Lathyru...

Q. Explain Use of Toxic amino acids? Lathyrus sativus (kesari dhal) seeds contain toxic amino acid beta-oxalyl aminoalanine (BOAA), is considered to be responsible

Protozoa phylum, wht is the main quality of this phylum

wht is the main quality of this phylum

Explain the maltose and cellobiose, Explain the Maltose and Cellobiose? ...

Explain the Maltose and Cellobiose? Maltose consists of two a-D-glucose molecules with the alpha bond at carbon 1 of one molecule attached to the oxygen at carbon 4 of the se

Genetics, 5. Maple syrup urine disease is a rare inborn error of metabolism...

5. Maple syrup urine disease is a rare inborn error of metabolism. It derives its name from the odor of the urine of affected individuals. If untreated, affected children die soon

Eretmochelys imbricata, Ivory was much in demand for production of a variet...

Ivory was much in demand for production of a variety of jewellery and artifacts in the past. Reptile leather from crocodiles, lizards and snakes has quite a high demand for manufac

Explain semi-synthetic gums, Modified or Semi-synthetic Gums These are ...

Modified or Semi-synthetic Gums These are natural polymers, which are chemically modified to give a new product with improved functional properties. These also fall into severa

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd