Polymerase chain reaction, Biology

Assignment Help:

The PCR (polymerase chain reaction) is a biochemical technology in molecular biology to intensify a one or a little copies of a piece of DNA across several orders of magnitude generating thousands to millions of copies of an exacting DNA sequence. It is developed in the year of 1983 by Kary Mullis, PCR is now a common and frequent indispensable method used in biological and medical research labs for several of applications. These contains DNA cloning for sequencing and DNA-based phylogeny, the diagnosis of hereditary diseases;  functional analysis of genes; the recognition of genetic fingerprints which is used in forensic sciences and paternity testing and the detection and diagnosis of infectious diseases. In the year of 1993, the Mullis was awarded the Nobel Prize in Chemistry along with Michael Smith for his work on polymerase chain reaction.

 


Related Discussions:- Polymerase chain reaction

Autoregulation of coronary blood flow, The ability to maintain myocardial p...

The ability to maintain myocardial perfusion at constant levels in the face of changing driving presence is termed autoregulation. In normal cases, autoregulation is maintained at

What is lamarckism, What is lamarckism? Lamarckism is the theory that u...

What is lamarckism? Lamarckism is the theory that unites the law of use and disuse with the law of the transmission of acquired characteristics, i.e., that asserted that acquir

Arthropoda phylum, characteristic of spider that makes it the phylum arthro...

characteristic of spider that makes it the phylum arthropoda?

Function of amino acids, FUNCTIO N OF AMINO ACIDS Proteins are poly...

FUNCTIO N OF AMINO ACIDS Proteins are polymers of amino acids. Glycine form porphyrin nucleus in chlorophyll and heme (= haem) proteins like haemoglobin and cytochrome

What do you mean by primary metabolites, Q. What do you mean by Primary Met...

Q. What do you mean by Primary Metabolites ? As the name indicates, primary metabolites are molecules involved in vital metabolic pathways. They are of universal occurrence and

Autonomic nervous system, A.N.S. (Autonimic Nervous System) Name given ...

A.N.S. (Autonimic Nervous System) Name given by Langley . Controled by Hypothelamus. Partially independent system. Controls involuntary actions as heart beat, breathing,

Show technical aspects of the postero-anterior film, Q. Show technical aspe...

Q. Show technical aspects of the postero-anterior film? 1) Identification: Patient identification and side marker must be present. 2) Centering: The thoracic spinous pro

Write out electronic configuration, Give number of valence electrons for te...

Give number of valence electrons for technetium. Write out electronic configuration for the valence electrons. Give the number of valence electrons and the number of electronic con

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define poverty and ignorance - cause of anaemia is dietary, Define Poverty ...

Define Poverty and ignorance - cause of anaemia is dietary? Low purchasing power of the communities and their consequent inability to meet the nutrient requirements, even after

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd