Explain non-starch polysaccharides, Biology

Assignment Help:

NON-STARCH POLYSACCHARIDES

A polysaccharide often termed as complex carbohydrate. Besides starch, a mixture of substances called non starch polysaccharide (NSP), also constitute carbohydrates.

Dietary fibre, a term familiar to all of us, is also known as non-starch polysaccharides (NSP). It is the name given to a group of materials found in the cell walls of plants which give the plant its structure and form. It includes those carbohydrates that are not digested or absorbed, but pass through to the colon where bacteria ferment them for energy, thereby stimulating their growth. Because the  term 'dietary fibre' describes a nutritional concept rather than a component of diet, it has been suggested that the term be phased out and replaced with the term 'NSP' but this has been difficult because the word fibre is so widely used.  Examples of NSP include cellulose, pectin, gums, beta-glucans etc. In this section we will learn about these different non-starch polysaccharides. The major polysaccharides in the plant cell wall are cellulose, carboxymethyl cellulose, hemicellulose and pectin. Let's learn about  them.

 


Related Discussions:- Explain non-starch polysaccharides

What is rh typing of mother & fetus hemolythemolytic disease, What is the R...

What is the Rh typing of the mother and of the fetus in the hemolytic disease of the newborn? In a hemolytic disease of the newborn the mother is Rh- and the fetus Rh+. In thes

Types of leukemia, Types of Leukemia Leukaemia may be chronic  or acut...

Types of Leukemia Leukaemia may be chronic  or acute and is classified  into  the  following  categories:  i)  Acute Lymphocytic Leukaemia (ALL) This is  the most comm

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine which seed is best for your lawn, Assume that your yard has many ...

Assume that your yard has many tall trees that result in about fifty percent of the yard being shaded and fifty percent of the yard being exposed to full sun. The shaded areas and

Define essentiality of sulphur for growth of micro-organism, Define essenti...

Define essentiality of Sulphur for growth of micro-organism? Sulphur is a part of some amino acids, some carbohydrates, biotin and thiamine. It is obtained either as elemental

Blood pressure, bloodpressure will be more in _ in than in_

bloodpressure will be more in _ in than in_

Chemolithoautotrophs - nutritional types of microorganisms, Explain Chemoli...

Explain Chemolithoautotrophs - Nutritional Types of Microorganisms These microorganisms use inorganic compound as source of energy and electron and CO 2 as a source of carbon.

Is herbivorism a form of predatism, Q. Is herbivorism a form of predatism? ...

Q. Is herbivorism a form of predatism? The Herbivorism is a form of predatism in which first order consumers feed from producers (plants or algae). For instance, fruits and bir

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd