Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
NON-STARCH POLYSACCHARIDES
A polysaccharide often termed as complex carbohydrate. Besides starch, a mixture of substances called non starch polysaccharide (NSP), also constitute carbohydrates.
Dietary fibre, a term familiar to all of us, is also known as non-starch polysaccharides (NSP). It is the name given to a group of materials found in the cell walls of plants which give the plant its structure and form. It includes those carbohydrates that are not digested or absorbed, but pass through to the colon where bacteria ferment them for energy, thereby stimulating their growth. Because the term 'dietary fibre' describes a nutritional concept rather than a component of diet, it has been suggested that the term be phased out and replaced with the term 'NSP' but this has been difficult because the word fibre is so widely used. Examples of NSP include cellulose, pectin, gums, beta-glucans etc. In this section we will learn about these different non-starch polysaccharides. The major polysaccharides in the plant cell wall are cellulose, carboxymethyl cellulose, hemicellulose and pectin. Let's learn about them.
What is the Rh typing of the mother and of the fetus in the hemolytic disease of the newborn? In a hemolytic disease of the newborn the mother is Rh- and the fetus Rh+. In thes
Types of Leukemia Leukaemia may be chronic or acute and is classified into the following categories: i) Acute Lymphocytic Leukaemia (ALL) This is the most comm
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
write a note on mode of nutrition
Assume that your yard has many tall trees that result in about fifty percent of the yard being shaded and fifty percent of the yard being exposed to full sun. The shaded areas and
Define essentiality of Sulphur for growth of micro-organism? Sulphur is a part of some amino acids, some carbohydrates, biotin and thiamine. It is obtained either as elemental
bloodpressure will be more in _ in than in_
Explain Chemolithoautotrophs - Nutritional Types of Microorganisms These microorganisms use inorganic compound as source of energy and electron and CO 2 as a source of carbon.
Q. Is herbivorism a form of predatism? The Herbivorism is a form of predatism in which first order consumers feed from producers (plants or algae). For instance, fruits and bir
xerophytes types
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd