Physical signs of mitral regurgitation, Biology

Assignment Help:

Q. Physical Signs of mitral regurgitation?

Pulse is of normal character but carotid upstroke may be brisk. Atrial fibrillation is often present in a patient with advanced disease. Blood pressure is normal. Jugular venous pressure is normal in compensated phase. Left ventricle is often dilated with a downward and laterally displaced forcible apex. A systolic left para sternal lift may be palpable as the regurgitant blood enters the left atrium and this is different from para sternal lift due to prominent right ventricle.

Occasionally systolic thrill of mitral regurgitation is palpable. First heart sound (S1) is usually soft in rheumatic mitral regurgitation but it is normal in mitral valve prolapse. Second heart sound (S2) may be widely split. A third heart sound (S3) may be palpable at the apex. A fourth heart sound (S4) may be seen with recent onset severe mitral regurgitations and sinus rhythm. A holosystolic murmur starting with S1 and ending with S2 due to mitral regurgitation is audible at apex. In mitral valve prolapse it is a mid systolic murmur starting after a mid systolic click.

Murmur radiates to axilla and back with a posteriorly directed jet as seen with anterior leaflet abnormalities, ischaemic and dilated cardiomyopathies. It radiates superiorly and medially towards base with posterior leaftlet abnormalities. Patients with severe mitral regurgitation due to valve pathology have loud and long murmurs while soft, short, barely audible early murmurs are present in patients with functional mitral regurgitation. Murmur is often not audible in patients with acute mitral regurgitation. Physical maneuvers like valsalva, squatting and respiration will help in differentiating it form other systolic murmurs. Mid diastolic murmur may follow an S3 especially in rheumatic mitral regurgitation and is unusual in mitral regurgitations of other etiologies.


Related Discussions:- Physical signs of mitral regurgitation

Organ transplant rejection, ORGA N TRANSPLANT REJECTION - Major his...

ORGA N TRANSPLANT REJECTION - Major histocompatibility complex is responsible for stimulating the rejection of tissue MHC is set of genes that code for cell surface glycopr

What do biomass pyramids represent, What do biomass pyramids represent? ...

What do biomass pyramids represent? Biomass pyramids show the sum of the masses of the individuals that participate in each trophic level of a food chain.

How vitamin k used to prevents bone loss, How Vitamin K used to Prevents bo...

How Vitamin K used to Prevents bone loss? Vitamin K is known to inhibit bone loss through inhibiting effect on osteoclast formation. Thus, adequate levels of vitamin K must be

Describe two differences among green algae and plants, Describe two differe...

Describe two differences among green algae and plants. Algae lack tissue differentiation and have no true roots, leaves and stems. The gametangia of algae are single-celled; th

Illustrate the structure of starch granule, The Starch Granule - Structure ...

The Starch Granule - Structure Starch is a polysaccharide, a chain of many glucose molecules. There are two types of glucose chains in starch. One is a simple chain called am

What is the heterotrophic hypothesis on the origin of life, What is the het...

What is the heterotrophic hypothesis on the origin of life? As per to the heterotrophic hypothesis the first living beings were very simple heterotrophic organisms that is not

Hazard analysis, Hazard Analysis Two steps recognized as preliminary a...

Hazard Analysis Two steps recognized as preliminary and detailed analysis of hazard are taken. Preliminary Hazard Analysis (PHA) serves two aims: (i) It can expedite bringi

Water soluble vitamins, Water Soluble Vitamins B-vitamins are abundant...

Water Soluble Vitamins B-vitamins are abundant in milk and other feeds. B-vitamins are synthesized by rumen microorganisms, beginning soon after a young animal begins feeding.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Concepts of epidemic disease and endemic disease, Q. What is the difference...

Q. What is the difference between the concepts of epidemic disease and endemic disease? The Endemic diseases are those that often affect people of a given place, many or few in

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd