Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Physical Signs of mitral regurgitation?
Pulse is of normal character but carotid upstroke may be brisk. Atrial fibrillation is often present in a patient with advanced disease. Blood pressure is normal. Jugular venous pressure is normal in compensated phase. Left ventricle is often dilated with a downward and laterally displaced forcible apex. A systolic left para sternal lift may be palpable as the regurgitant blood enters the left atrium and this is different from para sternal lift due to prominent right ventricle.
Occasionally systolic thrill of mitral regurgitation is palpable. First heart sound (S1) is usually soft in rheumatic mitral regurgitation but it is normal in mitral valve prolapse. Second heart sound (S2) may be widely split. A third heart sound (S3) may be palpable at the apex. A fourth heart sound (S4) may be seen with recent onset severe mitral regurgitations and sinus rhythm. A holosystolic murmur starting with S1 and ending with S2 due to mitral regurgitation is audible at apex. In mitral valve prolapse it is a mid systolic murmur starting after a mid systolic click.
Murmur radiates to axilla and back with a posteriorly directed jet as seen with anterior leaflet abnormalities, ischaemic and dilated cardiomyopathies. It radiates superiorly and medially towards base with posterior leaftlet abnormalities. Patients with severe mitral regurgitation due to valve pathology have loud and long murmurs while soft, short, barely audible early murmurs are present in patients with functional mitral regurgitation. Murmur is often not audible in patients with acute mitral regurgitation. Physical maneuvers like valsalva, squatting and respiration will help in differentiating it form other systolic murmurs. Mid diastolic murmur may follow an S3 especially in rheumatic mitral regurgitation and is unusual in mitral regurgitations of other etiologies.
ORGA N TRANSPLANT REJECTION - Major histocompatibility complex is responsible for stimulating the rejection of tissue MHC is set of genes that code for cell surface glycopr
What do biomass pyramids represent? Biomass pyramids show the sum of the masses of the individuals that participate in each trophic level of a food chain.
How Vitamin K used to Prevents bone loss? Vitamin K is known to inhibit bone loss through inhibiting effect on osteoclast formation. Thus, adequate levels of vitamin K must be
Describe two differences among green algae and plants. Algae lack tissue differentiation and have no true roots, leaves and stems. The gametangia of algae are single-celled; th
The Starch Granule - Structure Starch is a polysaccharide, a chain of many glucose molecules. There are two types of glucose chains in starch. One is a simple chain called am
What is the heterotrophic hypothesis on the origin of life? As per to the heterotrophic hypothesis the first living beings were very simple heterotrophic organisms that is not
Hazard Analysis Two steps recognized as preliminary and detailed analysis of hazard are taken. Preliminary Hazard Analysis (PHA) serves two aims: (i) It can expedite bringi
Water Soluble Vitamins B-vitamins are abundant in milk and other feeds. B-vitamins are synthesized by rumen microorganisms, beginning soon after a young animal begins feeding.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What is the difference between the concepts of epidemic disease and endemic disease? The Endemic diseases are those that often affect people of a given place, many or few in
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd