Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Do enzymes act better under basic or acid pH?
Most enzymes act in pH between 6 and 8, a range that corresponds to the general acidic level of blood and cells. There are enzymes, however, that act only under very basic or very acid pH. So enzyme activity depends on pH interval.
In the stomach, for example, the gastric juice has a very low pH, around 2, and there the enzyme pepsin acts to intensively absorb proteins. In the duodenum, pancreatic secretions increase the pH of the enteric juice for the action of other digestive enzymes, for example, trypsin.
classification
what is ecology
Define Metabolic utilization of carbohydrates? Following absorption, the monosaccharides enter the portal circulation and are carried to the liver. Both galactose and fructose
One example of animals having a single opening to the outside that serves both as mouth as well as anus is: 1. Octopus 2. Asterias 3. Ascidia 4. Fasciola Ascidia i
Which is the type of nitrogen waste birds produce? Why does this feature, besides being an adaptation to the terrestrial environment, also mean an adaptation to flight? Birds a
Give three examples of genetic engineering that are intended to improve crop plants. Genetic engineering of crop plants can improve resistance to pests, retard ripening, impro
Adverse effects of menactra The most common adverse reactions to Menactra include headache, fatigue and malaise, in addition to pain, redness and induration at the site of injec
Explain the Dietary Management of Sepsis and MODS? Patients suffering from sepsis and/or resultant multiple system organ dysfunctions are critically ill and admitted in the int
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Q. What are the pancreatic tissues involved respectively in the endocrine and exocrine secretions? What are their respective hormones and enzymes? The exocrine secretion of the
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd