Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Photoperiodism was first characterised in:
1. Tobacco
2. Potato
3. Tomato
4. Cotton
Tobacco is the first in whic photoperiodism characterised.
Explain ozone shield? Name two gases that can cause damage to this shield. Give one harmful effect of this damage each on plants and animals.
Spina Bifida Cystica There is a protrusion of meninges and spinal cord a) Meningocele- it is relatively uncommon lesion (4-5 per cent). In this there is protrusion of me
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Analyze the similarities and differences between chemosynthesis and photosynthesis. Determine what you believe is the most significant step in regard to harnessing energy within ea
How can we calculate the IVI from a total number of (30) quadrats (each 30 x 30 m quadrats)
Cnidaria - Protozoa The mature medusoid jellyfishes like Aurelia are the sexual stages. Sperms and eggs produced in the dissimilar (male and female) individuals ale released i
Explain Energy demand for Sedentary or Light Activity Lifestyles? These people have occupations that do not demand much physical effort, are not required to walk long distances
Management In case of small defects surgical treatment is not indicated because spontaneous closure may occur before one to two years of age. Patient is treated for conges
Name two possible why the number of live bacteria cell have reached the stationary growth by 60hrs and start to die off after 12hrs?
protozoa locomotion
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd