Photoperiodism was first characterised, Biology

Assignment Help:

Photoperiodism was first characterised in:

1. Tobacco

2. Potato

3. Tomato

4. Cotton

Tobacco is the first in whic photoperiodism characterised.

 


Related Discussions:- Photoperiodism was first characterised

Explain ozone shield, Explain ozone shield? Name two gases that can ca...

Explain ozone shield? Name two gases that can cause damage to this shield. Give one harmful effect of this damage each on plants and animals.

Spina bifida cystica, Spina Bifida Cystica There is a protrusion of me...

Spina Bifida Cystica There is a protrusion of meninges and spinal cord a) Meningocele- it is relatively uncommon lesion (4-5 per cent). In this there is protrusion of me

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine what is the most significant step, Analyze the similarities and d...

Analyze the similarities and differences between chemosynthesis and photosynthesis. Determine what you believe is the most significant step in regard to harnessing energy within ea

Important Value Index (IVI) calculation, How can we calculate the IVI from ...

How can we calculate the IVI from a total number of (30) quadrats (each 30 x 30 m quadrats)

Cnidaria - protozoa, Cnidaria - Protozoa The mature medusoid jellyfish...

Cnidaria - Protozoa The mature medusoid jellyfishes like Aurelia are the sexual stages. Sperms and eggs produced in the dissimilar (male and female) individuals ale released i

Energy demand for sedentary or light activity lifestyles, Explain Energy de...

Explain Energy demand for Sedentary or Light Activity Lifestyles? These people have occupations that do not demand much physical effort, are not required to walk long distances

Management of ventricular septal defect, Management   In case of  small...

Management   In case of  small defects surgical treatment is not indicated because spontaneous closure may occur before one to two years of  age. Patient  is treated for conges

Population and sigmoid curve, Name two possible why the number of live bact...

Name two possible why the number of live bacteria cell have reached the stationary growth by 60hrs and start to die off after 12hrs?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd