Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. Nutritional management for diarrhoea?
The conservative concept of treatment for diarrhoea was not in favour of feeding adequate amount of food. However, with the identification of varied underlying causes and not so positive outcomes of the starvation therapy, it has become evident that adequate nutritional care is pertinent to ensure enhanced recovery and proper rehabilitation. Dietary management of diarrhoea has changed completely over the years and it is now advocated th3t the patient should be prescribed a diet most suitable for the underlying etiology of diarrhoea. Today we know that the nutrient requirements and or the quality (consistency) of diet may not necessarily be the same for all forms of diarrhoea. While the demand for fluids and electrolytes are particularly high during an acute episode; that of all macro-and micronutrients increases during chronic diarrhoeas.
what are the adaptive features of this fish
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
OVARIES - 2 in number (didelphic). White / pinkish. Almond like. 3 cm long, 2 cm wide, 1 cm thick. Lie in the lower part of abdomen attached to dorsal wall by mesovarium.
Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon
Q. How many chambers do the mammalian heart and the bird heart have? Concerning temperature maintenance what is the benefit of the double and complete circulation of these animals?
Explain the Dietary Modifications - Obesity? The dietary modifications serve as a guide for the obese to make healthy food choices. The first step towards prescribing a diet fo
Explain Zalcitabine and adverse effects Zalcitabine - Zalcitabine appears to be less effective, less convenient and more toxic than the other NRTIs; it is used rarely. Ad
Explain Procedure for Checking the Presence of Rhodamine B? Conduct the experiment following the procedure given herewith: 1. Pour liquid paraffin or mineral oil in a Petri
Define Poverty Alleviation to control under nutrition? There are a number of development programmes aiming at employment assurance to the landless and other labour with a focus
Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd