Nutritional management for diarrhoea, Biology

Assignment Help:

Q. Nutritional management for diarrhoea?

The conservative concept of treatment for diarrhoea was not in favour of feeding adequate amount of food. However, with the identification of varied underlying causes and not so positive outcomes of the starvation therapy, it has become evident that adequate nutritional care is pertinent to ensure enhanced recovery and proper rehabilitation. Dietary management of diarrhoea has changed completely over the years and it is now advocated th3t the patient should be prescribed a diet most suitable for the underlying etiology of diarrhoea. Today we know that the nutrient requirements and or the quality (consistency) of diet may not necessarily be the same for all forms of diarrhoea. While the demand for fluids and electrolytes are particularly high during an acute episode; that of all macro-and micronutrients increases during chronic diarrhoeas.


Related Discussions:- Nutritional management for diarrhoea

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Female reproductive system - ovaries, OVARIES - 2 in number (didelph...

OVARIES - 2 in number (didelphic). White / pinkish. Almond like. 3 cm long, 2 cm wide, 1 cm thick. Lie in the lower part of abdomen attached to dorsal wall by mesovarium.

Explain nutritional management of metabolic diseases, Q. Explain nutritiona...

Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon

Benefit of the double and complete circulation, Q. How many chambers do the...

Q. How many chambers do the mammalian heart and the bird heart have? Concerning temperature maintenance what is the benefit of the double and complete circulation of these animals?

Explain the dietary modifications - obesity, Explain the Dietary Modificati...

Explain the Dietary Modifications - Obesity? The dietary modifications serve as a guide for the obese to make healthy food choices. The first step towards prescribing a diet fo

Explain zalcitabine and adverse effects, Explain Zalcitabine and adverse ef...

Explain Zalcitabine and adverse effects Zalcitabine - Zalcitabine appears to be less effective, less convenient and more toxic than the other NRTIs; it is used rarely. Ad

Explain procedure for checking the presence of rhodamine b, Explain Procedu...

Explain Procedure for Checking the Presence of Rhodamine B? Conduct the experiment following the procedure given herewith: 1. Pour liquid paraffin or mineral oil in a Petri

Define poverty alleviation to control under nutrition, Define Poverty Allev...

Define Poverty Alleviation to control under nutrition? There are a number of development programmes aiming at employment assurance to the landless and other labour with a focus

Define factors that affect the requirement of protein, Define Factors that ...

Define Factors that affect the requirement of Protein? Protein requirement is greatly influenced by many factors such as age, environmental temperature, energy intake, gender,

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd