Gluconeogenesis, Biology

Assignment Help:

Gluconeogenesis:  When  diet is deficient  incarbohydrates. Glucose  or glycogen is formed from noncarbohydrate compounds principally from certain amino acids  and the glycerol of triglycerides. This  is called  gluconeogenesis. It also  occur  mainly in the living organism. Its  importance lies more  in the fact  that certain  vital parts  of body  such  as  muscles, nervous  tissue, RBC lactating  mammary glands,etc. Hormones  promote, but insulin  inhibits  gluconeogensis.


Related Discussions:- Gluconeogenesis

explain alternative processing, Alternative polyadenylation sites Exa...

Alternative polyadenylation sites Exact pre-mRNAs hold more than single group of signal sequences for 3' end polyadenylation and cleavage.   In  some  cases,  the  area  of  t

Family is the basic unit of society - child care, Family  is the Basic Uni...

Family  is the Basic Unit of Society   Each child within a family needs love and security to develop feelings of  trust and self esteem. Each child is a unique individual who h

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which type of plant tissue is cork, Which type of plant tissue is cork? ...

Which type of plant tissue is cork? Cork, the material, for example, used to cap wine bottles, is extracted from the suber of a special oak known as cork oak.

Cell wall, CELL WALL Discovered by Robert Hooke , 1665 when he saw ...

CELL WALL Discovered by Robert Hooke , 1665 when he saw dead empty cork cells. Bonne r - studied the chemical nature of cell wall. The cell wall is a rigid & prote

Define objective of taxonomy -assemblage of knowledge gained, Define Object...

Define Objective of Taxonomy - Assemblage of Knowledge Gained? A second objective of taxonomy is the assemblage of knowledge gained. This is usually in the form of treatises us

What is the energy source used in active transport, Q. What is the energy s...

Q. What is the energy source used in active transport through biological membranes? The energy necessary for active transport against the concentration gradient of the transpor

Define health effects related to probiotics, Define Health Effects related ...

Define Health Effects related to Probiotics? Several lines of evidence support the conclusion that normal gut microflora are involved in resistance to disease, especially gastr

Excretory system of animals and human urinary system, steps in urine format...

steps in urine formation and the organs/tissues involve in such process?

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd