Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Gluconeogenesis: When diet is deficient incarbohydrates. Glucose or glycogen is formed from noncarbohydrate compounds principally from certain amino acids and the glycerol of triglycerides. This is called gluconeogenesis. It also occur mainly in the living organism. Its importance lies more in the fact that certain vital parts of body such as muscles, nervous tissue, RBC lactating mammary glands,etc. Hormones promote, but insulin inhibits gluconeogensis.
Alternative polyadenylation sites Exact pre-mRNAs hold more than single group of signal sequences for 3' end polyadenylation and cleavage. In some cases, the area of t
recent research on golgi bodies
Family is the Basic Unit of Society Each child within a family needs love and security to develop feelings of trust and self esteem. Each child is a unique individual who h
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Which type of plant tissue is cork? Cork, the material, for example, used to cap wine bottles, is extracted from the suber of a special oak known as cork oak.
CELL WALL Discovered by Robert Hooke , 1665 when he saw dead empty cork cells. Bonne r - studied the chemical nature of cell wall. The cell wall is a rigid & prote
Define Objective of Taxonomy - Assemblage of Knowledge Gained? A second objective of taxonomy is the assemblage of knowledge gained. This is usually in the form of treatises us
Q. What is the energy source used in active transport through biological membranes? The energy necessary for active transport against the concentration gradient of the transpor
Define Health Effects related to Probiotics? Several lines of evidence support the conclusion that normal gut microflora are involved in resistance to disease, especially gastr
steps in urine formation and the organs/tissues involve in such process?
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd