Name two stimulant drugs, Biology

Assignment Help:

Name two stimulant drugs and state the undesirable side-effects of each.

Amphetamine and cocaine are stimulant drugs. The side-effects of amphetamines are high blood pressure; unwarranted self-confidence and decreased accuracy. Cocaine can cause arterial constriction and mental disorders. The after-effects of both drugs can be severe depression.

 


Related Discussions:- Name two stimulant drugs

Lithosphere, The lithosphere contains all of the hard solid land of the ear...

The lithosphere contains all of the hard solid land of the earth crust and the semisolid land underneath the crust. The surface of the lithosphere is very uneven contains high moun

Frog, why frog respire through skin

why frog respire through skin

Digitalis toxicity, Symptoms of digitalis toxicity include anorexia, nausea...

Symptoms of digitalis toxicity include anorexia, nausea, headache, blurring or yellowing of vision, and disorientation. Cardiac toxicity may take the form of atrioventricular condu

Living organisms, List the five kingdoms into which most living organisms c...

List the five kingdoms into which most living organisms can be classified. Most living organisms can be classified as a) Bacteria, b) Protozoa, c) Fungi, d) Plants,

What will happen to membranes, What might happen to membranes if many -OH g...

What might happen to membranes if many -OH groups were added to the tails of phospholipids?

Define population size, Define Population size, inbreeding and genetic vari...

Define Population size, inbreeding and genetic variation? "Darwin proposed, and modern evolutionary biology affirms, that evolution is relies on variation in the characteristic

Illustrate the diabetic contract of the eye, Illustrate the diabetic contra...

Illustrate the diabetic contract of the eye? Diabetic Cataract: 1) Sorbitol Aldose Pathway: In patients with diabetes, there is increase in sugar alcohol which results in

Peptide bond, PEPTID E BOND Peptide or amide bond is a linkage es...

PEPTID E BOND Peptide or amide bond is a linkage established condensation reaction between amino group of one amino acid and carboxylic group of the second amino acid.

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Which bound to hemoglobin, Which of the following are bound to hemoglobin w...

Which of the following are bound to hemoglobin when hemoglobin is in the R-state? Choose all that apply. 1. Fe2+ 2. CO2 3. 2,3-bisphosphoglycerate 4. Fe3+ 5. Oxygen

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd