Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Name the corrosion resistant metals
Most of the corrosion resistant metals or alloys used for implants have a layer of oxides on their surface. The thin (approximately 5 nm) layer on the surface of titanium is amorphous, becoming crystalline if further oxidation and thickening occurs. Ti-6Al-4V has similar thickness, mixed oxide amorphous films in which the composition depends on the treatment (e.g., V is only visible in surface spectra of passivated Ti alloy specimens, whereas in non passivated specimens the surface layer is Al rich), in addition to the main elements, impurities typically present include Ca, P, Si, Cl, S, Na and F.
Q. What and how many are the pulmonary veins? The pulmonary veins are part of the pulmonary circulation they are vessels that carry oxygen-rich (arterial) blood from the lungs
Calculate a 95% confidence interval for the difference among the average numbers of ant species in the two regions. Compare your results to SPSS output and interpret the confidence
What are the main types of waste? The waste can be classified into main types, each of them carrying its own dissimilar environmental problem: organic waste, non recyclable was
Puerperal Psychosis: Child birth can precipitate schizophrenia, depression and mania. Management: it depends on the nature of the symptoms. Danger to self and othcrs (inc
Q. As a result of the DNA replication two DNA molecules come into existence. Why is it not correct to assert that the two "new" DNA molecules are created? What is the name given to
Normal 0 false false false EN-IN X-NONE X-NONE MicrosoftInternetExplorer4
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Name two possible why the number of live bacteria cell have reached the stationary growth by 60hrs and start to die off after 12hrs?
Suppose many of the atoms of nitrogen in a double-stranded molecule of DNA, of isotope N-14, were replaced with the isotope N-15. What afffect would this have? a) The nitrogeneo
Low levels of dissolved salts characterise the freshwater biomes. The salt content of fresh water is about 0.005 percent. The freshwater biomes consist of inland bodies of standing
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd