Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Myelinated fibre
Axon is a relatively long process (also quite often referred to as nerve fibre) and can be considered as functionally specialised for conduction of excitation over considerable distances. In vertebrates the axons of high velocity neurons are covered by insulating sheaths of lipid containing myelin. This myelin is made up of special glial cells -the Schwann cells. The myelin covering is not continuous. There are tiny uninsulated gaps between adjacent Schwann cells. These are the-nodes of Ranvier. The myelin covering and nodes of Ranvier help accelerate the speed of conduction of impulses by a mechanism which we will discuss later. The terminal part of the axon branches, terminating into small ramifications whose tips form end knobs which synaptically contact with other nerve cells. In the end knobs are present characteristic structures called synaptic vesicles which contain and store chemical substances called neurotransmitters.
Figure: Myelinated fibre
The diversity in neuron form, however so much that is there can be many variations from the generalized description given above. For example, the nerve cells called amacrine cells found in retina contain processes without a demonstrable axon.
Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon
The capacity to do work is known as energy. In an ecosystem energy flows through one organism to another in the form of food. The flow of energy is uni-direction and non cycle and
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Explain the Decolourizing Agent - Ziehl-Neelsen Method? Acid alcohol - a mixture of 95% ethanol and 3% HCI - is used for decolourization. Before decolourization, smear is allow
Define about the Ishihara's Plates of eyes Ishihara's Plates: Following plates are available- Transformation, Vanishing, Hidden Digit and Diagnostic plates. 1) The plates ar
New advancements and discoveries related to oogenesis
what is meant by double penetration sex?
MOLECULAR MECHANISM OF HORMONE ACTION - Once a hormone enters the bloodstream it can reach almost any cell in the body. However, each hormone affects only certain kinds of c
Third Week - Embryonic Development Throughout the third week of development the ICM separates from the uophoblast and forms the flattened embryonic disc, which at first consi
According to the Mendel's second law, in the crossing between homozygous individuals concerning two pairs of nonlinked alleles, AABB x aaBB, what are the phenotypical and genotypic
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd