Myelinated fibre, Biology

Assignment Help:

Myelinated fibre

Axon is a relatively long process (also quite often referred to as nerve fibre) and can be considered as functionally specialised for conduction of excitation over considerable distances. In vertebrates the axons of high velocity neurons are covered by insulating sheaths of lipid containing myelin. This myelin is made up of special glial cells -the Schwann cells. The myelin covering is not continuous. There are tiny uninsulated gaps between adjacent Schwann cells. These are the-nodes of Ranvier. The myelin covering and nodes of Ranvier help accelerate the speed of conduction of impulses by a mechanism which we will discuss later. The terminal part of the axon branches, terminating into small ramifications whose tips form end knobs which synaptically contact with other nerve cells. In the end knobs are present characteristic structures called synaptic vesicles which contain and store chemical substances called neurotransmitters.

349_Myelinated fibre.png

Figure: Myelinated fibre

The diversity in neuron form, however so much that is there can be many variations from the generalized description given above. For example, the nerve cells called amacrine cells found in retina contain processes without a demonstrable axon.


Related Discussions:- Myelinated fibre

Explain nutritional management of metabolic diseases, Q. Explain nutritiona...

Q. Explain nutritional management of metabolic diseases? The nutritional management of metabolic diseases such as gout and a few inborn errors of metabolism such as phenylketon

Energy flow in an eco-systems, The capacity to do work is known as energy. ...

The capacity to do work is known as energy. In an ecosystem energy flows through one organism to another in the form of food. The flow of energy is uni-direction and non cycle and

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the decolourizing agent - ziehl-neelsen method, Explain the Decolou...

Explain the Decolourizing Agent - Ziehl-Neelsen Method? Acid alcohol - a mixture of 95% ethanol and 3% HCI - is used for decolourization. Before decolourization, smear is allow

Define about the ishihara''s plates of eyes, Define about the Ishihara's Pl...

Define about the Ishihara's Plates of eyes Ishihara's Plates: Following plates are available- Transformation, Vanishing, Hidden Digit and Diagnostic plates. 1) The plates ar

Oogenesis, New advancements and discoveries related to oogenesis

New advancements and discoveries related to oogenesis

Sexology, what is meant by double penetration sex?

what is meant by double penetration sex?

Molecular mechanism of hormone action, MOLECULAR MECHANISM OF HORMONE ACTIO...

MOLECULAR MECHANISM OF HORMONE ACTION - Once a hormone enters the bloodstream it can reach almost any cell in the body. However, each hormone affects only certain kinds of c

Third week - embryonic development, Third Week - Embryonic Development ...

Third Week - Embryonic Development Throughout the third week of development the ICM separates from the uophoblast and forms the flattened embryonic disc, which at first consi

What are phenotypical & genotypical proportions in f1 & f2, According to th...

According to the Mendel's second law, in the crossing between homozygous individuals concerning two pairs of nonlinked alleles, AABB x aaBB, what are the phenotypical and genotypic

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd