Monosaccharides, Biology

Assignment Help:

MONOSACCHARIDES

  • Simple carbohydrate monomers, which cannot be hydrolysed further into simpler or smaller subunits.
  • Monosaccharides are generally colourless, crystalline and mostly sweet to taste.
  • The empirical formula is (CH2O)where n = 3 to 7.
  • A monosaccharide with aldehyde group is called aldose, generally having suffix as ose.
  • A monosaccharide with keto group is ketose, generally having suffix as ulose.

SOME COMMON ALDOSES AND KETOSES

MONOSACCHARIDE

ALDOSE

KETOSE

1. Trioses

 

2. Tetroses

 

3. Pentoses

 

4. Hexoses

 

5. Heptoses

Glyceraldehyde

 

Erythrose, Threose

 

Ribose, Deoxyribose, Xylose, Arabinose

 

Glucose, Galactose, Mannose

 

Glucoheptose, Galactoheptose

Dihydroxy acetone

 

Erythrulose

 

Ribulose

 

Fructose

 

Sedoheptulose

1.       TRIOSES

  • The monosaccharides posses three carbons, e.g. Glyceraldehyde (an aldose) and Dihydroxy acetone (a ketose).
  • They are formed in both respiration and photosynthesis.

2.      TETROSES

  • The monosaccharides posses four carbons, e.g. Erythrose,Threose, Erythrulose.
  • Tetroses are intermediates of photosynthetic and respiratory pathways as well as raw materials for many biochemicals.
  • Erythrose is raw material for synthesis of anthocyanin & lignin.

3.       PENTOSES

  • They are with 5-carbon monosaccharides, e.g. Arabinose, Deoxyribose, Ribose, Ribulose, Xylose, Xylulose.
  • Deoxyribose is also a pentose sugar but has one oxygen atom less at 2nd C, formula is C5H10O4.It is component of DNA.
  • Ribose is raw material for synthesis of ribonucleotides, cAMP, ATP, NAD, NADP, FAD and RNA.
  • Ribose and Deoxyribose sugars are involved in formation of nucleotides.
  • Some pentose sugars are intermediates of photosynthetic and respiratory pathways.
  • Arabinose and xylose produce wall materials.
  • Arabinose present in gum of Accacia.
  • Ribulose present in RuBP.

4.       HEXOSES

  • They are six-carbon monosaccharides, e.g. Fructose, Galactose,Glucose, Mannose.
  • Fructose is fruit sugar but absent in grapes. It is also the sweetest of all natural sugars with sweetness index of 170. Also known as laevulose.
  • Glucose is blood sugar with a sweetness index of 70. It is raw material for formationof complex carbohydrates.
  • Glucose is the main respiratory substrate that is oxidised by every cell in order to obtain energy.
  • Glucose is reserve carbohydrates in grapes (Grape Sugar).
  • Gluscose is also known as dextrose.
  • Glucose present in the form of open chain or ring form.

2154_gluvose and fructose.png

  • Galactose does not occur freely but is a component of lactose, agar-agar, glycolipids and glycoproteins.
  • Galactose is milk sugar or brain sugar.
  • Galactose is fastly circulated in blood.
  • Mannose is found in cell wall and many prosthetic polysaccharides.
  • Mannose is also found in wood with component of hemicellulose.
  • Mannose is not found in free form.

5.       HEPTOSES

  • Heptoses are seven - carbon monosaccharides.
  • e.g., Glucoheptose, Galactoheptose, Sedoheptulose.
  • Sedoheptulose is intermediate of both photosynthetic and respiratory pathways.

708_heptose.png


Related Discussions:- Monosaccharides

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain the development of sirs or mods, Explain the Development of SIRS or...

Explain the Development of SIRS or MODS? Multiple hypothesis have been proposed to explain the development of SIRS or MODS. The progression of SIRS to MODS appears to be mediat

Explain the use of benzoates acid, Q. Explain the use of Benzoates acid? ...

Q. Explain the use of Benzoates acid? Benzoic acid, sodium benzoate and the parahydroxy esters (parabens) are used as preservatives. Benzoic acid and its sodium salt, sodium be

Parthenocarpy, Parthenocarpy It is generally observed that the fruit d...

Parthenocarpy It is generally observed that the fruit develops after fertilization and it has fertile seeds inside it. However, this is not always so. Fruits of certain variet

How can you categorize flowering plants, Q. What are the two major groups i...

Q. What are the two major groups into which flowering plants are divided? Angiosperm plants are separated into monocotyledonous (monocots) and dicotyledonous (dicots).

Where are blood cells made in the body, Where are blood cells made in the b...

Where are blood cells made in the body? Blood cells are made in the red bone marrow, e.g. in the ribs, sternum or vertebrae.

Disbeliefs about insulin injection, Some people have disbeliefs regarding i...

Some people have disbeliefs regarding insulin injection. You have to find out if there are any disbeliefs and try to explain the importance of insulin injection. Do not force the p

What is lymphatic network, What is Lymphatic Network? The lymphatic net...

What is Lymphatic Network? The lymphatic network consists of the lymphatic vessels, which circulate lymph throughout the body. Lymph is a liquid which carries out exchange of g

Which molecule should be most radioactive, Yeast is cultured in the presenc...

Yeast is cultured in the presence of radioactive phosphate and the following biological molecules are purified. Which molecule should be most radioactive? A. An oligosaccharide B.

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd