Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Q. What is Cardiac tamponade?
Cardiac tamponade is that situation where increase in pericardial fluid raises the intrapericardial pressure which interferes with diastolic filling. This leads to decreased ventricular filling resulting in low cardiac output.
Ideal Characteristics 1) Maximize gas transfer (oxygen, carbon dioxide and anaesthetic gases) 2) Minimize blood trauma 3) Good heat transfer efficiency 4) Minimize
Write the meaning of balanced diet. 1) Balanced Diet means diet which contains a variety of foods in such quantities and proportions that the need for energy, proteins, vitami
Q. Living beings are made of inorganic and organic substances. According to the molecular complexity how can each of those substances be classified? Inorganic substances, mole
Q. How does the circulatory system participate in the functioning of the endocrine system? The circulatory system is basic for the functioning of the endocrine system and the b
How can amine groups be classified? Amines can be classify into primary amines, those to which one -R (variable radical) is attached to a -NH2, secondary amines, those where on
In studies of human body, which of the below terms is used to describe the first step in production of urine? Is it: a) Tubular reabsorption b) Tubular secretion c) Glome
What are the antigens and the respective antibodies of the ABO blood group system? The ABO blood system contain the erythrocytic antigens A and B that can be attacked by the an
Seminal plasma in human males is rich in : 1. fructose and calcium 2. glucose and calcium 3. DNA and testosterone 4. ribose and potassium Fructose and Calcium
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Define Regulation of Water Balance - For the Digestive Process? For the digestive process alone, the estimated daily volume of fluid that enters and leaves the gastrointestinal
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd