Locomotion in arthropoda, Biology

Assignment Help:

Locomotion in Arthropoda

The Arthropods are characterized by the existence of some special features which can be considered key to their success. These involve a rigid exoskeleton made up of a Chitinous cuticle which resists deformation, metameric segmentation of the body, and jointed appendages build up of a system of levers. The jointed arthropod limb and its associated muscles allow highly complex movements. Besides, the haemocoel has replaced the septate coelomic cavity of the Annelida. The muscular body wall is broken down into distinct, separate muscles. This allows precise and localized contractions. This in turn has greatly reduced dependence on the hydrostatic skeleton for locomotion, increasing efficiency of locomotion.


Related Discussions:- Locomotion in arthropoda

Explain adverse effects of indinavir, Explain Adverse effects of Indinavir ...

Explain Adverse effects of Indinavir   In addition to adverse effects similar to those of other protease inhibitors, indinavir causes elevation of indirect bilirubin, indinavir

Explain iron uptake by cells, Explain Iron Uptake by Cells? Iron partic...

Explain Iron Uptake by Cells? Iron participates in a large number of biochemical reactions. However, for iron to perform any function, it first needs to be taken up by the cell

Nested brackets as a cladogram, using either nested brackets as a cladogram...

using either nested brackets as a cladogram, what are the hierarchical relationships among the followingtaxa:raniates, amniotes, mammals, actinopterygians, chondrichthyes, aves, ve

Contagious bovine pleuropneumonia, C o n t a g i o u s bovine pleu...

C o n t a g i o u s bovine pleuropneumonia It is a disease of bovines characterized by high rise of body temperature and difficulty in respiration. E t iolo

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Effect on microbial ecology and food spoilage of ph, Q. Effect on Microbial...

Q. Effect on Microbial Ecology and Food Spoilage of pH? The acidity of a product plays an important role in deciding the type microflora present in food and the rate and type o

The skin, what is vaso-constriction

what is vaso-constriction

Define food behaviour - public nutrition, Define Food Behaviour - Public Nu...

Define Food Behaviour - Public Nutrition? Food is not merely a means to survival but the fuel that drives the human body and the economic engine. What influences what we decide

Ilustrate about corvous caurinus, When we watch animals in the wild, most o...

When we watch animals in the wild, most often we see them foraging for food. The foraging behaviour of animals has been a focus of behavioural studies for many decades. Natura

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd