Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
LIPIDS
Explain the Composition of MacConkey Agar? Bactopeptone - 17.0 gm Protease Peptone - 3.0 gm Lactose - 10.0 gm Bile salt mixture - 1.5 gm Sodium chloride - 5.0 gm
Your task is to describe genetic algorithms, explain why genetic algorithms are useful in solving the problem you have been set and conduct an investigation into the optimum parame
Q. List down the various mycotoxins associated with food? Mycotoxins associated with foods are: • Aflatoxins (produced by Aspergillus flavus) • Ochratoxin (produced
reproduction mode
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
How many different proteins, each composed of 8 amino acids, can be constructed using the 20 different amino acids found in proteins?
how can you find the coded genes for each piece of DNA?
Responses of Plants to Stress You know that certain plant species can grow in severe environmental extremes. For example, plants grow below 0°C in the Himalayas and above 45°C
Determine the Occurrence of vitamin A In the vegetable kingdom, vitamin A probably occurs in the form of its provitamins which belong to the group of carotenes. Carrots, spina
Explain about the primary protein derivatives? a) Proteins: These are the insoluble products which result from the incipient action of very dilute acids or enzymes. e.g. casein
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd