Lipids, Biology

Assignment Help:

LIPIDS

  1. Term given by Bloor.
  2. Lipids do not form polymers in nature except cutin (polymere of fatty acids).
  3. Most lipids are formed of fatty acids & alcohol.
  4. Ester bond is formed between them.
  5. In each fatty acid 1 carboxyle group is present.
  6. Lipids are formed of Carbon, Hydrogen and often Oxygen where Oxygen content is very small as compared to other two elements.
  7. Some lipids also contain small amounts of Phosphorus, Nitrogen are rarely Sulphur.
  8. Lipids require more oxygen for their complete oxidation as compared to carbohydrates.
  9. On their oxidation maximum water is released, so hump of camel is made up of fat.
  10. They contain and liberate almost double the energy of carbohydrates.
  11. Lipids are insoluble in water but soluble in organic solvent, e.g. alcohol, acetone, ethers, carbon tetrachloride.
  12. Lipids are micromolecules.
  13. When in solution of glycerophosphide weak sound waves are passed, little lipid is dissolved in sol & liposome is formed.


Related Discussions:- Lipids

Explain the composition of macconkey agar, Explain the Composition of MacCo...

Explain the Composition of MacConkey Agar? Bactopeptone - 17.0 gm Protease Peptone - 3.0 gm Lactose - 10.0 gm Bile salt mixture - 1.5 gm Sodium chloride - 5.0 gm

Explain genetic algorithms, Your task is to describe genetic algorithms, ex...

Your task is to describe genetic algorithms, explain why genetic algorithms are useful in solving the problem you have been set and conduct an investigation into the optimum parame

List down the various mycotoxins associated with food, Q. List down the var...

Q. List down the various mycotoxins associated with food? Mycotoxins associated with foods are: • Aflatoxins (produced by Aspergillus flavus) • Ochratoxin (produced

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain different amino acids found in proteins, How many different protein...

How many different proteins, each composed of 8 amino acids, can be constructed using the 20 different amino acids found in proteins?

Microarrays, how can you find the coded genes for each piece of DNA?

how can you find the coded genes for each piece of DNA?

Responses of plants to stress, Responses of Plants to Stress You know ...

Responses of Plants to Stress You know that certain plant species can grow in severe environmental extremes. For example, plants grow below 0°C in the Himalayas and above 45°C

Determine the occurrence of vitamin A, Determine the Occurrence of vitamin ...

Determine the Occurrence of vitamin A In the vegetable kingdom, vitamin A  probably occurs in the form of its provitamins which belong to the group of carotenes. Carrots, spina

Explain about the primary protein derivatives, Explain about the primary pr...

Explain about the primary protein derivatives? a) Proteins: These are the insoluble products which result from the incipient action of very dilute acids or enzymes. e.g. casein

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd