How can triglycerides be decreased, Biology

Assignment Help:

Q. How can triglycerides be decreased?

Triglycerides could be decreased by:

- limiting foods high in fats

- decreasing sugar and sugar containing foods (carbonated beverages, fruit drinks, sweet snacks and desserts, honey, jam, jelly, chocolates and candy)

- decreasing alcohol intake

- reducing portion size

- striving for reducing weight, and

- increased physical exercise

Having understood the etiology, symptoms and dietary management of dyslipideinia we will now proceed to learn about an important clinical manifestation of elevated lipids that remains asymptomatic for a long time - atherosclerosis.


Related Discussions:- How can triglycerides be decreased

Explain about the food spoilage, Explain about the Food Spoilage? Foods...

Explain about the Food Spoilage? Foods gradually undergo deterioration or spoilage from the time they are harvested, caught, slaughtered or manufactured. Therefore, delay in th

Therapeutics for infective endocarditis, Therapeutic   Accurate identif...

Therapeutic   Accurate identification of the infecting organism is the key to successful treatment.  Antibiotics as per the sensitivity study in high doses IV is given.

Design of expression vectors in transgenic animals, D esig n of expressio...

D esig n of expression vectors Expressing a transgene in an appropriate manner is a huge task. The gene construct that is quite active in transfected cells may be only weakl

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Define the management of epileptic patients, Define the Management of Epile...

Define the Management of Epileptic Patients? The primary treatment of epilepsy is anticonvulsant drugs. The focus of nutritional management is a diet, which is appropriate for

What are the grasslands of north america, What are the grasslands of North ...

What are the grasslands of North America and of South America respectively called? The steppe grasslands of North America are known as prairies. The grasslands of South America

Determine energy expenditure for climbers, Determine energy expenditure for...

Determine energy expenditure for Climbers? The energy expenditure of 3250 Kcal/ day is reported in climbers to Mt. Everest using doubly labeled water teaching. Out of this, 161

Explain about true-breeding petunia plant with white petals, A true-breedin...

A true-breeding petunia plant with red petals was crossed with another true-breeding petunia plant with white petals. The plants of the F1 progeny had blue petals. When these F1 pl

Define the integrity of gut or colon - dietary fiber, Define the Integrity ...

Define the Integrity of gut or colon? Dietary fibre especially fermentable fibres play an important role in maintaining the integrity of gut. SCFAs generated during fermentatio

What are biopolymers, Q. What are biopolymers? Polymers are macromolecu...

Q. What are biopolymers? Polymers are macromolecules made by the union of several smaller identical molecules, called monomers. Biopolymers are polymers present in the living b

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd