Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Homozygous and Weterozygous
In an individual two identical alleles may exist [or a given character and, hence, the individual is referred to as Homozygous (e.g. AA and aa). If there are two non-identical or different alleles for a given character, the indivitlual is reffered to as heterozygous (e.g. Aa).
Let us examine a situation where both the parents arc homozygous. The male is homozygous recessive aa, and female is homozygous dominant AA. During nlciosis in the male the two 'a' alleles separate from each other so lhat cach spcrln has only asingle 'a' allele. Similarly, in the female parent each egg has one 'A' allelc. 'I'hc fertilisation of the 'A' egg by 'a' sperm results in n hcterozygoiis atiimal with 'Aa'. The form of gene which occurs in an individual in nalure is called the 'wild type' while a 'mutant type' is the one in which the genetic material is somcwhat altered. Mutants arise due to various reasons.
The alleles which express themselves in both honiozygous and heterozygous conditions are known as the dominant alleles. For example, 1T represents tallricss (homoqgous). The individuals having the alleles TT, and Tt would be tall as T is a dominant allele and it can express itself in both homozygous and heterozygous conditions. Some alleles express themselves only in hornozygous condition ant1 arc rcfcrrcd to as recessive alleles. In the height characteristic, dwarfness can be seen in individuals that have the alleles 'tt', i.e., recessive allelus are expresscti in homozygous condition only.
Q. What are the major cellular features of fungi? There are pluricellular and unicellular fungi. All fungi are heterotrophs and eukaryotes. Fungi have cells with cell wall m
Explain the term Indirect Calorimetry? This method estimates energy expenditure by determining the oxygen consumption and carbon dioxide production of the body or a cell over a
Why do you think the energy requirements are different in situations? Well the requirement is dependent on the ways in which the body spends energy. For example in the first c
Is there vaccine against tuberculosis? The vaccine against tuberculosis is known as BCG (bacillus Calmette-Guérin). BCG is not used in some countries where tuberculosis is not
Q. Why is the plant life cycle known as alternation of generations? The plant life cycle is called as alternation of generations because in this cycle there are two different f
Q How do antagonistic mechanisms manage homeostatic regulation? The homeostatic maintenance of the body typically occurs by means of alternating antagonistic compensatory mecha
How does the intensity of facilitated diffusion vary in relation to the concentration of the moved substance? What is the limiting factor? Like simple diffusion facilitated dif
Explain in details Class Hirudenia - Leeches? This group includes the leeches. Most leeches grow in tropical freshwater habitats, and are familiar to most people as bloodsucker
note about water microbiology
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd