Genetic material, Biology

Assignment Help:

Assuming that variability of populations were non-genetic, that is, not controlled by genetic material, once again chance events alone would determine which of the organisms would survive. But phenotypic traits of a1 organisms'have a genetic component and heritable to some degree. If an individual has some form of a trait that gives him a better chance of survival in a given environment, evidently his offspring inherit the trait. This is known as differential survival. Differential survival *auld refer to the survival of individuals in an environment to which they are well adapted. Individuals who do not possess such adaptations for the given environment may not survive to reproduce. The adaptations are genetically controlled and heritable. Differential survival leads to differential reproduction of alleles responsible for the survival of the next generation. In fact it is customary to say that natural selection is synonymous with differential reproduction. The consequence of differential reproduction is not so much that individuals survive, but that such individuals are able to perpetuate their genes in subsequent generations. Thus what really survives is the set of genes.


Related Discussions:- Genetic material

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Depth and currents, Depth and Currents Depth The sea is v...

Depth and Currents Depth The sea is very deep varying in different regions. Generally life extends to all depths but is confined more to the continental shelf and

Biotic potential curve and the real population growth curve, Q. What is the...

Q. What is the relationship between environmental resistance and the population growth according to the biotic potential curve and the real population growth curve? The differe

Can you explain genetic code, Q What is genetic code? Genetic code is t...

Q What is genetic code? Genetic code is the key for the conversion of the DNA nucleotide sequences and thus the RNA nucleotide sequences into amino acids sequences that will co

What is cellular grade. explain in brief., What is Cellular grade? Explain ...

What is Cellular grade? Explain in brief. Organisms with this kind of cellular organization are referred to as the parazoan. They have distinct cells which function independent

Explain protein stabilized food emulsions, Protein Stabilized Food Emulsion...

Protein Stabilized Food Emulsions Many food products are emulsions (eg. milk cream, ice creams, cream, butter etc.) and protein constituents often play a major role in the stab

Does seed germination affect plant growth, Does seed germination affect pla...

Does seed germination affect plant growth? Germination does affect plant growth Without germination in the plant, the plant is not capable to grow. The germination is the st

#Erosion, In what ways does over-grazing lead to soil erosion?

In what ways does over-grazing lead to soil erosion?

Define the contraceptive morbidity, Define the Contraceptive Morbidity ...

Define the Contraceptive Morbidity Contraceptive morbidity, which covers any condition that result from efforts (other than abortion) to limit fertility, whether they are tradi

Type one diabetes mellitus, Q. Type one Diabetes Mellitus? Type 1 DM oc...

Q. Type one Diabetes Mellitus? Type 1 DM occurs in children and adolescents (6-14 yrs). In this disease, the body makes little or no insulin. Daily injections of insulin are ne

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd