Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Which are the glands present in the epidermis of mammals, birds and reptiles? In the epidermis of birds and reptiles there are almost no glands. In mammals there are sweat glan
Types of xerophytes On the basis of their mbrphology, physiology and life cycle pattern, xerophytes are generally classified into the following three categories: a) Ephem
Q. Where does most of the water resorbed after glomerular filtration go? What are the other substances resorbed by the nephron tubules? Only 0.5 to 1% of the glomerular filtrat
Disposal : Opaque bags are the recommended for disposing off carcasses. You should also put freshly dissected animals and tissues into opaque plastic bags, seal them and dispose t
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
In a twin study of 1000 MZ pairs, 625 pairs were found to have both twins with the same form of a given trait. In a study of 1000 DZ twins, 426 pairs were found to have both twins
Why are the tropical forests also known as stratified forests? In tropical forests tall trees of various species have their crowns forming a superior layer under which diverse
What is Ventricular Septal Defect (VSD) ? VSD accounts for 15-20 per cent of all CHDs. The ventricular septum may be divided into a small membranous portion and a large muscula
Define Dietary Management of Cancer Patients and Feeding Problems Related To Cancer Therapy? We took an overview about the general nutritional requirements of cancer patients.
Q. Water has key participation in organic reactions. What are examples of two types of organic reactions in which water is respectively incorporated or liberated in the products of
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd