Explain the term- pedon and polypedon, Biology

Assignment Help:

Explain the term- pedon and polypedon

The characteristics of soil do not change vertically downwards only, there are lateral variations also as soil is a three dimensional body. Therefore, a three dimensional sample within a soil, called a  pedon, is chosen as a unit to represent the nature and arrangement of horizons and variability in the properties of soil.

A group of similar pedons that are surrounded on all sides by "non-soil" or by pedons of unlike character is called a  polypedon. A schematic s ketch of a soil pedon in relation to the soil, polypedon and soil profile is shown in Fig. In the following subsection you will study about the characteristics of profile of a given soil. It is important for the classification of the soil as well as in putting the soil to an appropriate use.

545_soil.png


Related Discussions:- Explain the term- pedon and polypedon

Why did scientists want to map the human genome, Why did scientists want to...

Why did scientists want to map the human genome? They wanted to learn the location of all the significant genes in the genome in order to learn how the genome is organized, ho

Explain water soluble vitamins for infants, Explain Water soluble vitamins ...

Explain Water soluble vitamins for Infants? Thiamin, riboflavin and niacin requirements are met through breast milk alone and solely breast-fed infants meet their requirements.

What is the life cycle of trypanosoma cruzi, What is the life cycle of Tryp...

What is the life cycle of Trypanosoma cruzi? Trypanosoma cruzi is a heteroxenous parasite, i.e., it has an intermediate host, the triatomine bug, and an ultimate host, the hum

Two-kingdom classification, Two-Kingdom Classification The history of ...

Two-Kingdom Classification The history of taxonomy is as old as man himself. It may be traced back to prehistoric times because man had learnt to designate living organisms by

Tallness trait of a pea plant, What is the tallness trait of a pea plant mo...

What is the tallness trait of a pea plant moving separately from the color trait an example of? This is an instance of Mendel's second law, the Law of Independent Assortment, w

Infant botulism, In infant botulism, viable botulinal spores are ingested a...

In infant botulism, viable botulinal spores are ingested and upon germination in the intestinal tract, toxin is synthesized. It is confined to infants under a year of age. High num

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Proteins of plant origin - vegetable proteins, Proteins of Plant Origin ...

Proteins of Plant Origin Vegetable Proteins: Fresh vegetables are not considered to be a very good source of proteins. On fresh weight basis, the average protein content of s

Name the source gland of leutinising hormone, Name the source gland of leut...

Name the source gland of leutinising hormone (LH). State the other hormone along with which it acts on its target cells/organ. Give their two functions.

How does menstrual cycle begin, Does the hypophysis-ovaries endocrine axis ...

Does the hypophysis-ovaries endocrine axis work in the same way during pregnancy as in non-pregnant women? If pregnancy does not occur how does another menstrual cycle begin? T

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd