Explain the small intestine, Biology

Assignment Help:

Explain the Small Intestine?

The small intestine is made up of three sections, the duodenum, the jejunum, and the ileum. Bile from the liver and pancreatic enzymes are released into the first section of the small intestine, the duodenum, where most of the overall digestion occurs although it is short - only about 25 cm. Their arrival triggers the production of mucus and the release of digestive enzymes from the glands at the base of projections called villi found in the mucus lining of the intestine. Villi function to expand the exposed surface area of the cell membranes in order to increase the rate of absorption of processed nutrients passing through the digestive tract. Each finger-like villus membrane surface is itself covered with millions of microvilli - even tinier finger-like projections of cell membrane, giving the small intestine a huge surface area for transport of nutrients. Enzymes secreted by the intestinal wall include lipases to split fats into glycerol and fatty acids; peptidases that break proteins down into amino acids; and maltase, lactase, and sucrase, that convert disaccharides into monosaccharides. The products of digestion are delivered to the circulatory system by a process called absorption. Absorption takes place through the villi into capillaries and lymph vessels called lacteals that line the intestine. Fatty acids formed in the interior space or lumen of the intestine diffuse into the mucosa, where triglycerides are synthesized and combined with cholesterol and phospholipids, then coated with protein to form water-soluble chylomicrons, which are carried into the lacteals and eventually into the blood stream near the heart through the large lymph duct called the thoracic duct. The products of digestion of sugars and proteins are carried by the capillaries to the liver, where the glucose is converted to glycogen for storage, and the rest of the nutrients are filtered for detoxification and then distributed by the blood stream to the rest of the body.


Related Discussions:- Explain the small intestine

Illustrate the metabolism of cornea, Illustrate the metabolism of cornea? ...

Illustrate the metabolism of cornea? Metabolism of Cornea: The corneal epithelium plays several roles in the process of image formation. Its apical cell border interacts

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Explain doctrine of signatures, Explain Doctrine of Signatures? Handed ...

Explain Doctrine of Signatures? Handed down from the ancients, and elaborated on by the herbalists, was the 'Doctrine of Signatures', which was based on features that resembled

Mechanism of cleavage, Mechanism of Cleavage Such as the mitotic divi...

Mechanism of Cleavage Such as the mitotic division in any cell, cleavage is the result of two events: mitotic nuclear division (Karyokinesis) followed via cytoplasmic divisio

Reproduction, what is the difference between anaisogyami & oogyami?

what is the difference between anaisogyami & oogyami?

How is the cooling of tissues and organs, Q. How is the cooling of tissues ...

Q. How is the cooling of tissues and organs for medical transplants associated with the effect of temperature upon enzymatic reactions? The molecular degradation during the dec

Define initiation phase - mechanism of protein synthesis, Define Initiation...

Define Initiation phase - mechanism of protein synthesis ? The assembly of a ribosome on an mRNA molecule at the correct start point, the initiation codon. Three initiation fac

Chromophore - development of plant, Chromophore - Development of plant ...

Chromophore - Development of plant The chromophore is a tetrapyrrole molecule like chlorophyll, but unlike chlorophyll it is an open tetrapyrrole and contains no metal ion. It

What is the relationship between hypothesis and a theory, What is the relat...

What is the relationship between the following scientific terms: hypothesis, a theory, and a natural law?

Spirogyra, whats the meaning of asexual reproduction

whats the meaning of asexual reproduction

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd