Explain the mendel''s laws in genetics, Biology

Assignment Help:

Explain the Mendel's Laws in genetics?

Based on the results of his experiments, Mendel proposed three laws regarding the inheritance of traits: the Law of Segregation, the Law of Independent Assortment, and the Law of Dominance.

The first principle proposed by Mendel, the Law of Segregation, states that "factors" responsible for inheritance of traits remain separate in the offspring, rather than blending . Because traits not apparent in the F1 generation reappeared in the F2 generation, and the F2 generation also had two factors, Mendel concluded that each parent carried two factors that segregate, or separate, during the formation of sperm or egg cells so that they each carry only one factor; therefore the offspring had two factors, the same as the parent.
Since Mendel studied a number of traits, he found that alleles governing different traits, such as position of flowers along the stem; position, shape, and color of the pod; height of the plant; seed texture, seed color, and seed coat color, segregate independently from the alleles that govern another trait. This formed the basis of the second principle, the Law of Independent Assortment. We will see that this law applies only to genes found on different chromosomes.

The third principle, the Law of Dominance, was a result of Mendel's discovery that when two strains were cross-pollinated, one factor in a pair, the dominant factor, may mask the other, so that the dominant trait is always observed in the F1 generation. He called a factor recessive if the trait did not appear until the F2 generation. Some traits were found to exhibit incomplete dominance; that is, heterozygous plants had phenotypes intermediate between the dominant and the recessive. An example is a dominant red flowered plant and recessive white-flowered producing pink-flowered offspring. If dominant traits produce different phenotypes, and both appear in heterozygotes, the traits are called codominant.

539_variations on the mendelian theme.png

There are traits such as skin color in humans that have more than two phenotypes and result from contributions from two or more genes. This condition is called polygenic inheritance. In its simplest form, two genes code for the same trait; an example is kernel color in wheat, where two genes have two alleles, R for red pigment and R' for no pigment at all. The resulting phenotypes exhibit incomplete dominance as with heterozygous single alleles, but there are more shades of red because there are more genes contributing to the trait.


Related Discussions:- Explain the mendel''s laws in genetics

Cultural and religious values, Wildlife has influenced language, art, relig...

Wildlife has influenced language, art, religion and social customs of many societies worldwide, and wild animals figure prominently in many cultures even today. In all cultures of

Nitrogen fixation, Nitrogen Fixation As we have said before, atmospher...

Nitrogen Fixation As we have said before, atmospheric nitrogen cannot be used by plants or animals. It has to be first fixed. The term nitrogen fixation refers to the oxidatio

Observation of bumpus, An interesting observation made by an American biolo...

An interesting observation made by an American biologist H.C. Bumpus (1899) provides a good explanation for normalising selection. Bumpus collected some 136 injured house sparrows

Accidents resulting in death, Accidents Resulting in Death Accidents t...

Accidents Resulting in Death Accidents that cause death are dealt with in a different way. The law requires full compensation to the widow for complete life or until remarriag

Define why the virginia opossum is considered a generalist, Define why the ...

Define why the Virginia opossum is considered a generalist and the koala is considered a specialist. The opossum feeds on almost anything, whereas the koala feeds only on the l

Direct vs. indirect competition model, Pikas (component 1), also known as "...

Pikas (component 1), also known as "rock rabbits" or "coneys", are small relatives of rabbits belonging to the genus Ochotona. The 30 species in this genus are confined to high alt

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Cytokinesis, Cytokinesis It is defined  as the division or cleavage  of...

Cytokinesis It is defined  as the division or cleavage  of cytoplasmic  part   of the cells  into  two  daughter  cells. It is first  indicated   during  late  anaphase  by app

What is the constitution of the cartilaginous matrix, What is the constitut...

What is the constitution of the cartilaginous matrix? The cartilaginous matrix is made of collagen fibers, mostly collagen type II, and of proteoglycans, proteins associated to

Explain theory for determination of fungal and yeast count, Explain the The...

Explain the Theory or Principle for Determination of Fungal and Yeast Count? Fungi are widespread and present on food, equipments and processing and storage facilities. These a

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd