Explain the feeding process for preschoolers, Biology

Assignment Help:

Explain the Feeding process for Preschoolers?

The word preschool children, you may be aware, is used for children less than six years of age. After the first year, there is a sustained growth in childhood, which is not as rapid as in infancy yet the growth needs are high. Growth occurs in spurts; nevertheless children should grow @ 6-7 cm/year in height and 1.5-3 kg/year in weight. Further, the preschool years are characterized by increased physical activity.  Physical activity, you know, influences energy needs. Due to these physiological conditions, children during this period, in fact, are most susceptible to malnutrition.  Situations that promote malnutrition also favour a high incidence of infectious diseases, which in turn further contribute to the malnutrition. For many children, under five - and particularly those under three - years of age who live in these conditions, being sick or convalescing from diarrhoea or a respiratory infection is part of "normal life", because they experience this several times a year, with each episode lasting two to 15 days and requiring up to twice that time to achieve full recovery, provided that an intervening new episode of disease does not interrupt the recovery process.  Infections of this nature often result in negative energy balance resulting from poor appetite, decreased absorption of nutrients during diarrhoeal episodes and increased metabolic rate, particularly in febrile processes. This leads to chronic mild wasting (i.e. low weight-for-height) and stunting (i, e. low height-for-age), which may be  prevented, ameliorated or corrected if adequate care and food are available, especially  in the periods between infectious episodes when appetite has been re-established. If, on the contrary conditions do not improve, the status quo of mild malnutrition is maintained, the possibility for catch-up growth is reduced and the consequences of malnutrition will continue. Thus, the preschool period is the challenging period in normal nutrition.

Interestingly, this is also the time when eating habits get established among preschoolers. The family determines the feeding habits of children. Colour, flavour, texture, shape, stories appeal to make food choice among children. Food performances and total food intake fluctuates and change from time to time. Appetite is erratic. So then considering these factors how do we ensure proper nutrition and eating habits during these vulnerable years? Let's find out.

A nutritionally adequate diet is essential for optimal growth and development. Children below the age of five years should be given less bulky foods, but rich in energy and protein (such as cereal pulse combinations, legumes, pulses, eggs, meat etc.). Vegetables including green leafy vegetables and seasonal fruits should be part of their daily menu. Care should be taken that ingredient from all food groups get included in child's diet.

Note: Children 1-6 year consumes Y2-% the amount of cereals, pulses and vegetables as compared to sedentary woman but has an extra cup of milk.


Related Discussions:- Explain the feeding process for preschoolers

Head - structure of the sperm, Head - Structure of the Sperm It exhib...

Head - Structure of the Sperm It exhibits a diversity of shapes in different animal groups, e.g., spherical (teleost fishes), rod or lance shaped (amphibians), spirally twist

Why deficiency of folate take place, Why Deficiency of Folate take place? ...

Why Deficiency of Folate take place? If there is inadequate dietary folate, the activity of both the DNA and the methylation cycles, described above, will be reduced. A decrea

Disinfectant, General information about disinfectants A disinfectant is...

General information about disinfectants A disinfectant is a chemical that kills disease-causing agents on contact. Natural disinfection agents, such as sunlight, heat, keeping

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

How can we control to occur campylobacteriosis diseases, How can we control...

How can we control to occur Campylobacteriosis diseases If a person is suffering from campylobacteriosis, he can take an antibiotic such as ciproflaxin or azithromycin. Erythro

Calorie value, THE CALORIE VALUE - The amount of heat liberated fr...

THE CALORIE VALUE - The amount of heat liberated from complete combusion of 1gm food in a bomb caloriemeter (a closed metal chamber filled with O ) is its gross calorific

Explain nongonococcal urethritis, Nongonococcal nonchlamydial urethritis an...

Nongonococcal nonchlamydial urethritis and cervicitis Nongonococcal urethritis (NGU) in men is often nonchlamydial as well. Possibly caused by Ureaplasma urealyticum, Mycoplas

Methods of virus, How Viruses Multiply? Obligatory parasitism - Outsi...

How Viruses Multiply? Obligatory parasitism - Outside cells viruses are nonliving, inactive   particles but after entering into live cells these multiply fast by replication

Describe the dinosaurs in multimedia tutorials, Describe the Dinosaurs in m...

Describe the Dinosaurs in multimedia Tutorials? Travel back to a time when dinosaurs ruled the earth. Learn about the different types of dinosaurs and practice building your ow

Limiting factors of green plants, What are likely to be the limiting factor...

What are likely to be the limiting factors in a population of (a) green plants, (b) birds?  (a) In green plants the limiting factors are likely to be light, water, minerals, te

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd