Explain the birth in human biology, Biology

Assignment Help:

Explain the Birth in human biology?

In humans, birth of the infant occurs about 270 days after conception.

The period during which the uterus contracts to expel the newborn and the placenta is called labor. Sometimes, the first sign of labor is the rupture of the amnion and loss of amniotic fluid. The fluid escapes through the vagina. This is commonly referred to as when someone's "water breaks."

The beginning of labor is triggered by several stimuli. Toward the end of the third trimester of pregnancy, estrogen is produced in larger amounts, stimulating contractions of uterine muscle. The pituitary glands of both mother and fetus secrete oxytocin, that also stimulates uterine contraction. During this stage of labor, uterine contractions pull the cervix open (dilation) until it is large enough to allow the baby to pass through.

During the second stage, the baby's head moves into the vagina and is visible from the outside. As soon as the baby is out of the birth canal, it can breathe and can be independent of the mother's circulation, which is when the umbilical cord can be clamped and cut. The placenta and fetal membranes are expelled a few minutes to an hour after birth.

 


Related Discussions:- Explain the birth in human biology

Describe circulatory system, Circulatory system:  One of the eleven major b...

Circulatory system:  One of the eleven major body organ systems in animals; carbon dioxide, nutrients, transports oxygen, and waste products between the cells and the respiratory s

Cancer, Cancer ;  Cell  division , like  all other  biological  processes,...

Cancer ;  Cell  division , like  all other  biological  processes,  is under  genetic control. Certain  genes must regulate the processes  of cell growth  and division  in respons

Monocotyledonous embryo, Monocotyledonous Embryo The early developmen...

Monocotyledonous Embryo The early development of the proembryo in monocots follows the same pattern as in the dicots. However, at the time of differentiation in the globular

State the major function of the cell membrane, State the major function of ...

State the major function of the cell membrane A major function of the cell membrane is to maintain the characteristic integrity of the cell by forming a selective barrier betwe

What are toxic effects of lectins or haemagglutinins, What are toxic effect...

What are toxic effects of lectins or haemagglutinins? Well, these can cause growth inhibition in animals and diarrhoea, nausea, bloating and vomiting in case of human beings. W

Urology., what is the effect of KClO4 on the kidneys in the nephrotic syste...

what is the effect of KClO4 on the kidneys in the nephrotic system?

After purchasing - nursing software, After Purchasing The following po...

After Purchasing The following points should be considered for after purchase facilities. Avail of any training the software engineer or vendor may provide, even if it

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

DNA replication, What is cDNA and what is its function and mechanism of act...

What is cDNA and what is its function and mechanism of action?

Characteristics of nutrient uptake, Characteristics of Nutrient Uptake ...

Characteristics of Nutrient Uptake These results show certain characteristics of nutrient uptake. Selectivity: Certain mineral elements are taken up preferentiall

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd