Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Birth in human biology?
In humans, birth of the infant occurs about 270 days after conception.
The period during which the uterus contracts to expel the newborn and the placenta is called labor. Sometimes, the first sign of labor is the rupture of the amnion and loss of amniotic fluid. The fluid escapes through the vagina. This is commonly referred to as when someone's "water breaks."
The beginning of labor is triggered by several stimuli. Toward the end of the third trimester of pregnancy, estrogen is produced in larger amounts, stimulating contractions of uterine muscle. The pituitary glands of both mother and fetus secrete oxytocin, that also stimulates uterine contraction. During this stage of labor, uterine contractions pull the cervix open (dilation) until it is large enough to allow the baby to pass through.
During the second stage, the baby's head moves into the vagina and is visible from the outside. As soon as the baby is out of the birth canal, it can breathe and can be independent of the mother's circulation, which is when the umbilical cord can be clamped and cut. The placenta and fetal membranes are expelled a few minutes to an hour after birth.
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
You need to prepare 500 ml of a solution containing 10 mM Tris, 0.15 M NaCl and 1 mg/ml SDS. At your work disposal are stock solutions containing 1 M Tris, 2.5M NaCl and 10% (w/v)
Starch is a large molecule consisting of between 300 to 500 glucose molecules joined together. A glucose molecule is only very small, consisting of 24 atoms. Cellophane is simila
What are the major terrestrial biomes? The main terrestrial biomes are: tundra, taigas (or boreal forest), temperate forests, tropical forests, grasslands and deserts.
A saline drip is to be prepared for a lab experiment that is looking at hydration in lab rats. Calculate the amount of NaCl need to make 4 liters of a 0.9% solution.
What is the mode of nutrition in fish,human,amoeba,scorpian & toad ?
Your patient has a respiratory disease that has literally paralyzed the cilia. Explain why this patient would be at an increased risk for a respiratory infection.
Nutrition occurs in Protozoans All types of nutrition occur in Protozoa. Some protozoans synthesize their own food from inorganic precursors (carbon dioxide, nitrates or ammon
Explain Fungi - Nutritional Types of Microorganisms? Fungi are filamentous, eukaryotic microorganisms, ubiquitous in nature. These grow best in dark and moist habitats. Their h
Please help with the following: 32P is an unstable isotope of phosphorus that has a half-life of 14.29 days. Atoms of this isotope undergo beta decay in which a neutron decays i
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd