Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain the Bioavailability of Folate?
Bioavailability of folate from naturally occurring food sources is variable and frequently incomplete, as mentioned earlier in the food sources section. The bioavailability of natural folates is affected by the removal of the polyglutamate chain by the intestinal conjugase. This process is apparently not complete, thereby reducing the bioavailability of natural folates by as much as 25-5096. In contrast, synthetic folic acid appears to be highly bio available- 85% or greater. The low bioavailability and, more importantly, the poor chemical stability of the natural folates have a profound influence on the development of nutrient recommendations. This is particularly true if some of the dietary intake is as stable and bio available as the synthetic fonn, folic acid. Fortification of foods such as breakfast cereals and flour can add significant amounts of folic acid to the diet.
Since folic acid (synthetic) taken with food is 85% bio available but food folate is only about 50% bio available, folic acid taken with food is 85150 (i.e. 1.7) times more available. Thus, if a mixture of synthetic folic acid plus food folate bas been fed, dietary folate equivalents (DFEs) are calculated as follows to determine the EAR:
yg of DFE provided = [mg of food folate + (1.7 x mg of synthetic folic acid)].
To be comparable to food folate, only half as much folic acid is needed if taken on an empty stomach, i.e. lpg of DFE: = lmg of food folate = 0.5 mg of folic acid taken on an empty stomach = 0.6 mg of folic acid with meals.
Alcohol interferes with the absorption of folate and increases excretion of folate by the kidney.
CEREBRU M - Largest part of brain. 2/3 of brain. 4/5 of brain's weight. Cerebrum is devided into 2 cerebral hemispheres by longitudinal cerebral fissure. Gyri and sul
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
detail study of coelenterata
Cake mix evaluation Originally, cake mix formulations were very similar to bakery cakes and utilized standard "Hi-Ratio" cake oils; however, development of improved cake mixes
Nutrition chat
What is Hormones explain its role in humun body? Hormones are chemical signals that trigger responses in another part of the body. Once secreted, hormones move through the spa
Assume an experimental target that is to make vast amounts of a particular DNA fragment in pure form from a combination of DNA fragments. Whereas the DNA fragments can be introduc
Determine How to Calculate the Amount of Nitrogen? The amount of nitrogen can be calculated for this value using the equation: 1000 ml of 1N H 2 SO 4 = 1000 ml of 1N NH 3
human genome project
Explain the Management of Eating Disorders? We shall consider the components of the management of anorexia nervosa and bulimia nervosa together, since the nutritional consequen
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd