Explain some do's and don'ts when working in laboratory, Biology

Assignment Help:

Explain some Do's and Don'ts when working in Laboratory?

1) Always wear a lab coat when working a laboratory.

2) Ensure that no harm is caused to yourself or the people working aroundyou.

3) Keep your working table neat and avoid clutter.

4) Clean all spills immediately.

5) Clear all reagent bottles after use.

6) While heating test tubes on a flame, hold the mouth of the test tube in a direction that is away from yourself.

7) Do not discard acids, alkali or left over reagents in the sink.  Check with the lab staff for safe disposal of these reagents.

8) If you spill any acid or alkali on your hands or body, immediately wash the area in running water and immediately get help.

9) Do not pipette chemicals like strong acids, alkalis or reagents with strong odour. Use an auto pipettes or dispenser for this purpose.

10) Clean your glassware before leaving the laboratory. Check if the gas is switched off.


Related Discussions:- Explain some do's and don'ts when working in laboratory

Why is it significant that exact copies of dna, Why is it significant that ...

Why is it significant that exact copies of DNA are produced during replication? Producing exact copies make sure that when a cell divides, the offspring cells will receive the

What are the flat bones and the long bones, What are the flat bones and the...

What are the flat bones and the long bones? The major bones of the body may be divided as flat or long bones (there are bones not classified into these categories). Such as fla

Scope of dental implantology, From the above reading you must have understo...

From the above reading you must have understood how Dental implants have come into existence. Dental Implants are the future in dentistry and are becoming more and more widely used

Receptors, Receptors are sense organs that receive stimuli. On the basis...

Receptors are sense organs that receive stimuli. On the basis of their location in body receptors are of following types - 1 .       Extero receptor - Located at or near t

Primary tissues, what do primary tissues of a plant do

what do primary tissues of a plant do

Vaso-constriction, what is a vaso-constriction? what are the effects of vas...

what is a vaso-constriction? what are the effects of vaso-constriction in the skin?

What is monera, What is monera? One of the 5 main kingdoms contains bac...

What is monera? One of the 5 main kingdoms contains bacteria and blue/green algae. Does NOT have a cell membrane, or in other words, is made of prokaryotic cells. Actually,

Define two basic principles of food processing, Define two basic principles...

Define two basic principles of food processing? The fundamentals of food processing, as you may recall, involves the following two basic principles: Prepare the products

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd