Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
ABO blood groups in humans are controlled by the gene I. It has three alleles - IA, IB and i. As there are three dissimilar alleles, six different genotypes are possible. How many phenotypes can happen?
1. Three
2. One
3. Four
4. Two
Four phenotypes can occurs.
what is the life cycle of plasmodium vivax?
Among the different natural hazards, earthquakes happen to be the most feared and dangerous because of their sudden impact and the devastation they cause in a matter of few seconds
Define Changes in Food due to Concentration Process? Obviously concentration that exposes food to 100°C or higher temperatures for prolonged periods can cause major changes in
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Workgroup A Workgroup is a group of people who are working together on the same project. The members of such a group are usually (not always) located in close physical proximi
Skeletons of radiolarians The skeletons of radiolarians and foraminiferans form a primary constituent of ocean bottoms where they form 30% or more of the sediment. It is calle
Define role of Vitamin K in controlling gene expression? Prithrombin, a protein required for blood clotting is assembled with a large number of glutamic acid residues. In the p
What is meant by saying that in relation to a given trait conditioned by a gene with two different alleles the gametes are always "pure"? To say that gametes are pure means tha
Industrial melanism refers to the dark pigmentation that evolved in some insects giving them protective coloration on vegetation darkened by soot in heavily industrialized areas pr
Illustrate the tear flow direction of drainage. Tear Drainage: Tear are drained by the combined action of gravity, capillary action and lid movements (Lacrimal pump)
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd