Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Pediculosis and scabies
Phthirus pubis (pubic lice), which can be found on eyelashes, back, axillary and leg hairs as well as pubic areas, and Sarcoptes scabiei infestation (scabies) can both be transmitted sexually. The drug of choice for pubic lice is topical 1% permethrin, and for scabies is 5% permethrin. Oral ivermectin (Stromectol) (200 mcg/kg) is also effective as a single dose for treatment of lice, and has been used once daily for 3 days for resistant infections with scabies. Crusted scabies, a serious complication usually seen in patients with AIDS or other immunodeficiencies, should be treated with both permethrin and ivermectin.
Explain Zalcitabine and adverse effects Zalcitabine - Zalcitabine appears to be less effective, less convenient and more toxic than the other NRTIs; it is used rarely. Ad
biological significance of biology
The mathematical, statistical and computing methods that aim to resolve biological queries using DNA and amino acid sequences and related information is called as Bioinformatics.
Total Artificial Heart : Jarvik seven was the first successful total artificial heart supporting the patient for 112 days. The disadvantage is that the patient has to be connecte
Hirudinea - Feeding and Digestion in Annelids Hirudinea involves free living and ectoparasitic leeches. Leeches are blood suckers. The digestive system contains a preoral cham
Q. Can Obesity causes the cardiovascular disease? As you know obesity or excessive weight is the primary cause of cardiovascular disease. It is an independent risk factor for h
Explain Taxonomic Concepts and Their Development? The history of classification is an exciting aspect of plant taxonomy. The discovery of the use of plants for food and later
Explain transposition with VSD with restricted pulmonary? Transposition of great arteries with VSD with restricted pulmonary blood flow: Restriction to pulmonary blood flow
EYE HISTOR Y - Steva n described it first. Study of eye is ophthalmology. Instrument used to examine interior of eye is ophthalmoscop e . SHAP E - More o
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd