Explain pediculosis and scabies, Biology

Assignment Help:

Pediculosis and scabies 

Phthirus pubis (pubic lice), which can be found on eyelashes, back, axillary and leg hairs as well as pubic areas, and Sarcoptes scabiei infestation (scabies) can both be transmitted sexually. The drug of choice for pubic lice is topical 1% permethrin, and for scabies is 5% permethrin. Oral ivermectin  (Stromectol)  (200 mcg/kg) is also effective as a single dose for treatment of lice, and has been used once daily for 3 days for resistant infections with scabies. Crusted scabies, a serious complication usually seen in patients with AIDS or other immunodeficiencies, should be treated with both permethrin and ivermectin.

 


Related Discussions:- Explain pediculosis and scabies

Explain zalcitabine and adverse effects, Explain Zalcitabine and adverse ef...

Explain Zalcitabine and adverse effects Zalcitabine - Zalcitabine appears to be less effective, less convenient and more toxic than the other NRTIs; it is used rarely. Ad

Skeleton, biological significance of biology

biological significance of biology

What is bioinformatics, The mathematical, statistical and computing methods...

The mathematical, statistical and computing methods that aim to resolve biological queries using DNA and amino acid sequences and related information is called as Bioinformatics.

Total artificial heart in circulatory assist devices, Total Artificial Hear...

Total Artificial Heart :  Jarvik seven was the first successful total artificial heart supporting the patient for 112 days. The disadvantage is that the patient has to be connecte

Hirudinea - feeding and digestion in annelids, Hirudinea - Feeding and Dige...

Hirudinea - Feeding and Digestion in Annelids Hirudinea involves free living and ectoparasitic leeches. Leeches are blood suckers. The digestive system contains a preoral cham

Can obesity causes the cardiovascular disease, Q. Can Obesity causes the ca...

Q. Can Obesity causes the cardiovascular disease? As you know obesity or excessive weight is the primary cause of cardiovascular disease. It is an independent risk factor for h

Explain taxonomic concepts and their development, Explain Taxonomic Concept...

Explain Taxonomic Concepts and Their Development? The history of classification is an exciting aspect of plant taxonomy. The discovery of the use of plants for food and later

Explain transposition with vsd with restricted pulmonary, Explain transposi...

Explain transposition with VSD with restricted pulmonary? Transposition of great arteries with VSD with restricted pulmonary blood flow: Restriction to pulmonary blood flow

Receptors - eye, EYE HISTOR Y - Steva n described it first. S...

EYE HISTOR Y - Steva n described it first. Study of eye is ophthalmology. Instrument used to examine interior of eye is  ophthalmoscop e . SHAP E - More o

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd