Define st elevation in avr, Biology

Assignment Help:

Q. Define ST Elevation in aVR?

Lead aVR often develops ST elevation as a reciprocal of ST depression in lead V2 to V6 or leads 2 and 3. It may occasionally show ST elevation in the absence of significant changes in the other leads. aVR is positioned so that it reflects the left ventricular cavity and when the right and left coronary beds are ischaemic and cancel out, changes in the apex can be manifested. It has been suggested that ST elevation in aVR of a 0.5 mm is significant for ischaemia. It has been reported that this finding has a sensitivity of 89 per cent but a specificity of only 44 per cent for LAD disease.


Related Discussions:- Define st elevation in avr

Bud dormancy - plant growth substances, Bud Dormancy - Plant Growth Substan...

Bud Dormancy - Plant Growth Substances Environmental Factors The most important factor inducing dormancy appears to be photoperiod. Short days induce dormancy in many w

photosynthesis: light energy to synthesize , Photosynthesis happens in alg...

Photosynthesis happens in algae, green plants and photosynthetic bacteria. Its part is to catch solar energy and use this to drive the synthesis of carbohydrate from water and carb

Define methods for determining ph - nutritional biochemistry, Define Method...

Define Methods for determining pH? There are two general methods for determining pH of a solution. One is the colorimetric method and the other most common method is the use of

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Deoxyribonucleic acid (dna), Deoxyribonucleic acid (DNA) is the nucleic ac...

Deoxyribonucleic acid (DNA) is the nucleic acid composed of two polynucleotide strands wound around the central axis to form a double helix; the repository of genetic information.

Bacterial diseases-pigs, Pigs This is a sub-acute or chronic infection ...

Pigs This is a sub-acute or chronic infection manifested by abortion, sterility, high piglet mortality and orchitis in pigs. Br. suis causes brucellosis among pigs. It is morph

What is fermentation, What is fermentation? Name any two organic compounds ...

What is fermentation? Name any two organic compounds formed in this process

What are the two reproductive novelties of beings, Compared to amphibians w...

Compared to amphibians what are the two reproductive novelties of beings of the class Reptilia for the survival in dry environments? Compared to amphibians the two major reprod

Advantage of using the regulatory strategy of enzyme, You have two enzymes,...

You have two enzymes, 1 and 2. Both convert substance A into substance B. 1 is inhibited by B, because B partially blocks the active site and will not allow more A to enter. 2 is i

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd