Explain monascus species, Biology

Assignment Help:

Explain Monascus species

Most of the reports of food colourants from microbial sources involve Monascus species, particularly Monascus purpureus, followed by  Rhodotorula species,  Chlorella,  Nocardia and red algae. Often, instead of extracting the pigment from Monascus, a few researchers have attempted in adding the whole coloured substrate to foods for the purpose of providing colouration. Careful control of the culture conditions selectively improves the yield of various pigments elaborated by the specific microbial culture.

 


Related Discussions:- Explain monascus species

Describe the basic working of chemoreceptors, Q. Where are the chemorecepto...

Q. Where are the chemoreceptors that detect the acidity of the trigger and blood the respiratory compensation located? The chemoreceptors that participate in the ventilation co

What are the types of neurons, According to the function of the transmitted...

According to the function of the transmitted neural impulse which are the types of neurons? How different are the concepts of afference and efference of the neural impulse transmis

What is excessive cantilever, Excessive Cantilever Cantilevers in impla...

Excessive Cantilever Cantilevers in implant dentistry are commonly used especially in the mandibular arch for edentulous patients receiving implant supported prosthesis. Cantil

Features of amphibian gastrulation, Features of Amphibian Gastrulation ...

Features of Amphibian Gastrulation Major features of amphibian gastrulation are: Ectoderm surrounds the embryo by Epiboly. Gastrulation is initiated by a limited i

Explain electron transport chain, Explain Electron transport chain El...

Explain Electron transport chain Electron transport chain :Transport of high-energy electrons through a series of carriers in mitochondria.

What are the advantages of yoga, What are the advantages of Yoga Yoga h...

What are the advantages of Yoga Yoga has been derived from the Sanskrit word Yuj which means union. It is popular since ancient times. It is also one of the means to maintain f

Functions of protein, FUNCTION S OF PROTEIN Proteins from the collo...

FUNCTION S OF PROTEIN Proteins from the colloidal complex of the protoplasm and its organelles. Most Abundant Protein in Organic World is RUBISCO or Ribulose biphosp

Cell, the s phase of interface is important and a cell can newer divide wit...

the s phase of interface is important and a cell can newer divide without it justify?

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd