Explain environmental sampling - methods and techniques, Biology

Assignment Help:

Explain Environmental Sampling - Methods and Techniques?

Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.


Related Discussions:- Explain environmental sampling - methods and techniques

Agro industrial-enrichment of soil, Enrichment of soil Indirect provis...

Enrichment of soil Indirect provision of minerals to grazing livestock includes mineral fertilization of  pasture and altering soil pH, however this may not be always feasible

Excretory system, what is the excretory organ in protozoa?

what is the excretory organ in protozoa?

What are the types of colloidal dispersions, What are the types of colloida...

What are the types of colloidal dispersions Depending upon the relative affinity of the dispersed phase for the dispersion medium, colloidal dispersions are, further divided in

Regulation of the citric acid cycle, Regulation of the Citric Acid Cycle ...

Regulation of the Citric Acid Cycle The citric acid cycle is regulated by certain enzymes and by the availability of ADP.

What are instances of a carnivorous, Q What are instances of a carnivorous ...

Q What are instances of a carnivorous and an herbivorous reptile? Iguanas are herbivorous, Snakes are carnivorous. Q. Do beings of the class Reptilia perform gas exchange i

Describe in brief about retina, Describe in brief about retina The reti...

Describe in brief about retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. The

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Control of noise pollution, Following ways can be used for control of noise...

Following ways can be used for control of noise pollution: It can be controlled by designing, fabricating and using quiter machines. In heavy industries, sound proof insul

How many types of gametes can be formed, How many different types of gamete...

How many different types of gametes can be formed by individuals of the following genotypes? What are they in each case a) AaBb b) AaBB c) AaBbCc d) AaBBCc e) AaBbcc f) AaBbCcDdEe

Enema, Enema Enema may be given for the purpose of cleansing, for t...

Enema Enema may be given for the purpose of cleansing, for therapeutic purpose; to relieve intra-cranial pressure, abdominal distension, intusssception and for diagnostic p

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd