Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Environmental Sampling - Methods and Techniques?
Environmental sampling can be done for total microbial load or for some specific pathogens or spoilage organisms. The medium used is chosen accordingly. Different media like Brain Heart Infusion (BHI) broth, Plate-count agar with or without antibiotics, Pseudomonas isolation agar etc. can be employed, depending upon the purpose. Criteria for acceptable microbiological results from food contact surfaces depend on the food being processed in the facility. On the basis of nature of the site, degree of contamination and microbiological information sought, different sampling techniques can be employed for processing surfaces and air sampling.
Enrichment of soil Indirect provision of minerals to grazing livestock includes mineral fertilization of pasture and altering soil pH, however this may not be always feasible
what is the excretory organ in protozoa?
What are the types of colloidal dispersions Depending upon the relative affinity of the dispersed phase for the dispersion medium, colloidal dispersions are, further divided in
Regulation of the Citric Acid Cycle The citric acid cycle is regulated by certain enzymes and by the availability of ADP.
Q What are instances of a carnivorous and an herbivorous reptile? Iguanas are herbivorous, Snakes are carnivorous. Q. Do beings of the class Reptilia perform gas exchange i
Describe in brief about retina The retina is a highly complex layer of nervous tissue. The photoreceptors are rods and cones for scotopic and photopic vision respectively. The
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Following ways can be used for control of noise pollution: It can be controlled by designing, fabricating and using quiter machines. In heavy industries, sound proof insul
How many different types of gametes can be formed by individuals of the following genotypes? What are they in each case a) AaBb b) AaBB c) AaBbCc d) AaBBCc e) AaBbcc f) AaBbCcDdEe
Enema Enema may be given for the purpose of cleansing, for therapeutic purpose; to relieve intra-cranial pressure, abdominal distension, intusssception and for diagnostic p
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd