Explain class angiospermae, Biology

Assignment Help:

Class angiospermae (Flowering plants)

Flowers are the reproductive structures. Ovules are protected within ovary, xylem vessels are present. After fertilisation the ovary develops into fruit.


Related Discussions:- Explain class angiospermae

What are the three main signs of diabetes, What are the three main signs of...

What are the three main signs of diabetes? The three main signs of diabetes mellitus are called as the diabetic triad: polyuria, polydipsia and polyphagia. Polyuria is the e

Teratogens, TER A T OGEN S - These are chemicals or drugs causin...

TER A T OGEN S - These are chemicals or drugs causing malformed foetus . The production of monsters or malformed foetus is called tertogeny or teratogenesis . Th

Protein requirement in chronic diarrhoea, Q. Protein Requirement in chronic...

Q. Protein Requirement in chronic diarrhoea? Requirements are increased only in chronic diarrhoea because of associated tissue depletion. An additional 10 g of protein may be r

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Determine the organs of female reproductive system, What are the anatomical...

What are the anatomical relationships between the organs of the female reproductive system from the external vulva to the ovaries? The external female genitalia is called the v

Actions of gastrointestinal hormones, Actions of Gastrointestinal hormones ...

Actions of Gastrointestinal hormones Secretin is released under acidic conditions (low pH); digested fat or bile initiates production of pancreatic juice low in enzymes but ri

Embryonic induction and cell determination, Embryonic Induction and Cell De...

Embryonic Induction and Cell Determination The cell determination or fate of embryonic cells is regulated through factors which may reside within the embryonic cells or by the

Gene vs mrna , Obtain the sequence for the gene and the sequence for the RN...

Obtain the sequence for the gene and the sequence for the RNA transcript in FASTA format. If there is more than one transcript choose and appropriate one and explain your choice. U

Human physiology, which bones forms lhe non moving muscle attachment in

which bones forms lhe non moving muscle attachment in

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd