Explain basic concepts of nutrition science, Biology

Assignment Help:

Explain Basic Concepts of Nutrition Science?

Food is the very basis of our life, the food we eat, though the process of digestion, we know, is converted into nutrients, and these nutrients are absorbed, transported to different parts of the body, and utilized for the clay-to-day functioning, at the end of which they are disposed of by further metabolism and transformation into the end products. We need to consume a variety of foods in order to remain healthy. A simple thumb rule is to classify foods into different food groups. The basic seven-food groups concept is useful in getting a balanced diet that helps us to remain healthy.


Related Discussions:- Explain basic concepts of nutrition science

Explain the predator-prey relationships, Explain the Predator-Prey Relation...

Explain the Predator-Prey Relationships ? The feeding by a population of one species upon members of another species is referred to as predation. Many scientists also consider

Advantage of using a patient''s own stem cells, What would be the advantage...

What would be the advantage of using a patient's own stem cells e.g. blood stem cells, to treat his or her illness? The benefit of using stem cells from the patient being trea

What is protein synthesis, What is Protein Synthesis? Protein Synthesi...

What is Protein Synthesis? Protein Synthesis :  Protein synthesis begins in the nucleus, with the formation of mRNA from a DNA template through transcription. The function of

Dissociative (conversion) disorders, DISSOCIATIVE  (CONVERSION) DISORDERS: ...

DISSOCIATIVE  (CONVERSION) DISORDERS: There is normally a considerable degree of conscious control over the memories and sensations that can be selected for immediate attentio

Zoo201, In an outline form only, attempt the classification of the phylum a...

In an outline form only, attempt the classification of the phylum arthropoda

Defense mechanisms used in diabetes mellitus, Q. Defense mechanisms used in...

Q. Defense mechanisms used in Diabetes Mellitus? Defense mechanisms are the strategies to cope with the real situation and to maintain self-image. Healthy persons normally use

Chances of hypothermia, Name two ways in which the chances of hypothermia c...

Name two ways in which the chances of hypothermia can be reduced during outdoor activities. Eating well before going out and wearing warm, wind-proof clothing can reduces the c

N-terminal cysteine amino acid , Below is the N-terminus of an open reading...

Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis.  ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT

Describe about congenital cardiac conditions encountered, Describe about Co...

Describe about Congenital Cardiac Conditions Encountered in Adults ? The entire population of adults with CHD is constituted by patients whose cardiac malformations have a natu

Special situations of pulmonary embolism, Q. Special situations of Pulmonar...

Q. Special situations of Pulmonary Embolism? The CXR is often abnormal in pulmonary embolism. Atelectasis and other focal pulmonary parenchymal abnormalities are the most commo

Write Your Message!

Captcha
Free Assignment Quote

Assured A++ Grade

Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!

All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd