Already have an account? Get multiple benefits of using own account!
Login in your account..!
Remember me
Don't have an account? Create your account in less than a minutes,
Forgot password? how can I recover my password now!
Enter right registered email to receive password!
Explain Basic Concepts of Nutrition Science?
Food is the very basis of our life, the food we eat, though the process of digestion, we know, is converted into nutrients, and these nutrients are absorbed, transported to different parts of the body, and utilized for the clay-to-day functioning, at the end of which they are disposed of by further metabolism and transformation into the end products. We need to consume a variety of foods in order to remain healthy. A simple thumb rule is to classify foods into different food groups. The basic seven-food groups concept is useful in getting a balanced diet that helps us to remain healthy.
Explain the Predator-Prey Relationships ? The feeding by a population of one species upon members of another species is referred to as predation. Many scientists also consider
What would be the advantage of using a patient's own stem cells e.g. blood stem cells, to treat his or her illness? The benefit of using stem cells from the patient being trea
What is Protein Synthesis? Protein Synthesis : Protein synthesis begins in the nucleus, with the formation of mRNA from a DNA template through transcription. The function of
DISSOCIATIVE (CONVERSION) DISORDERS: There is normally a considerable degree of conscious control over the memories and sensations that can be selected for immediate attentio
In an outline form only, attempt the classification of the phylum arthropoda
Q. Defense mechanisms used in Diabetes Mellitus? Defense mechanisms are the strategies to cope with the real situation and to maintain self-image. Healthy persons normally use
Name two ways in which the chances of hypothermia can be reduced during outdoor activities. Eating well before going out and wearing warm, wind-proof clothing can reduces the c
Below is the N-terminus of an open reading frame of a gene that has been cloned into the E. coli expression plasmid pTrcHis. ATGTCTCTACCTCAGAGCAGGTGGGTGGCATGTTTCAGTATTGAGGGAATT
Describe about Congenital Cardiac Conditions Encountered in Adults ? The entire population of adults with CHD is constituted by patients whose cardiac malformations have a natu
Q. Special situations of Pulmonary Embolism? The CXR is often abnormal in pulmonary embolism. Atelectasis and other focal pulmonary parenchymal abnormalities are the most commo
Get guaranteed satisfaction & time on delivery in every assignment order you paid with us! We ensure premium quality solution document along with free turntin report!
whatsapp: +91-977-207-8620
Phone: +91-977-207-8620
Email: [email protected]
All rights reserved! Copyrights ©2019-2020 ExpertsMind IT Educational Pvt Ltd